Skip to main content

Advertisement

Table 1 List of primers used in this study

From: Evaluation of novel inducible promoter/repressor systems for recombinant protein expression in Lactobacillus plantarum

Name 5´–3´ Sequence
PlacSynth_SacI_EcoRI_F GATGACGAGCTC GAATTCTGGTCTTTATTCTTCAA
M13_R_NheI CGACGAGCTAGCAGCCAGGAAACAGCTATGACC
mCherry_RBS_XbaI GCTGCTTCTAGAAAGGAGGAAATTATACATGTTATCAAAGGGTGAAGAAG
mCherry_R_BamHI CGTCGTGGATCCTTATCACTTGTATAATTCATCCATACC
Tldh_amp_R_PstI CTGCTGCTGCAGAAAAAGATTAAAAAAGCCGCTGC
mCherry_seq_R TGGACGACCTTCACCTTCAC
mCherry_seq_F AACGTATGTACCCAGAAGATG
CAT_seq2_back TACATCATTCTGTTTGTGATGG
B_mega_XylOP_out_F AACATATAAACAGCCAGTTGCC
B_mega_XylOP_R(SpeI, ScaI, BamHI) GTAGTAGGATCC AGT ACTAGTTTCCCCCTTTGATTTAAGTG
mCherry_w/o_RBS_XbaI CGTCGTTCTAGAATGTTATCAAAGGGTGAAGAAGATAAC
p256_miniori_for CATCATAAGCTTCCCGCACGCATAGCGGTGC
B_mega_XylOP_F_MfeI, KpnI GTAGTACAATTG GGTACCAAGGTGAGGGTGGAGACAG
Bmega_XylR_newRBS_XbaI_Phos_R GTATAATTTCCTCCTTTCTAGAAGTGAACAAGTTTATCCAT
mCherry_Phos_F ATGTTATCAAAGGGTGAAGAAG
B_mega_XylOP_seq_F CAATTCCGATATTAATACTGATG
B_mega_XylOP_seq_R CTAGTCGGAATAGGAATTTGTG
LacI_Lplant_F_SacI AGCAGCGAGCTCCCTAATAGAACTGCGGTGGTC
LacI_Lplant_R_XbaI AGCAGCTCTAGAAACTTAATTACGCTTTAACAGC
lacR_Gal_seq_R AATTGAAGTGATGCGGGTCTG
lacR_Gal_seq_F AATTGCGCCAGCTAACACCC
T7_RNAP_Lp_RBS CAGCAGTCTAGATCCTAAAGGAGG
T7_RNAP_Lp_Term_R_SalI CAGCAGGTCGACTTGATATACAAAAAAGG
M13_2_F TTGTAAAACGACGGCCAGTG
T7-Promoter_SacI GCTGCTGAGCTCAGATCGATCTCGATCCCGCG
T7-Terminator_SalI GCTGCTGTCGACTCCGGATATAGTTCCTCCTTTC
ery_back_KasI CATCATGGCGCCTCCGATTGCAGTATAAATTTAACG
oripE194_seq_back AATCAAATCGGTATAAATCTGAC
Ery_F_NheI CATCATGCTAGCTCCGATTGCAGTATAAATTTAACG
Pempty_SacI_R TAGTAGTCTA GA GCTCGAATTCACTGGCCGTCG
mCherry_RBS_SacI_F GCTGCTGAGCTCAAGGAGGAAATTATACATGTTATCAAAGGGTGAAGAAG
  1. Restriction sites are underlined and highlighted in bold or italics