Skip to main content

Advertisement

Table 3 Oligonucleotides used in this study

From: Systems analysis of methylerythritol-phosphate pathway flux in E. coli: insights into the role of oxidative stress and the validity of lycopene as an isoprenoid reporter metabolite

Name Oligonucleotide sequence
rph repair T*T*T*G*CCAGCGCCGCCTTCTGCGTCGCTACAATGGATTCGATTCCCCCTCGGGCCAGAGCCAACAAGATGAGTAGCTCTTCATGGGTGAAC
PEF-F02 ATAACAATTTCACACAGGAAACAGACCATGGGATTAAAGAGGAGAATACTAGATG
PEF-R02 CAAGCTTGCATGCCTGCAGGTCGACTCTAGATCAGGAACTCATGATTTCCAGTG
PEF-F04 ATAACAATTTCACACAGGAAACAGACCATGGGATTAAAGAGGAGAATACTAGATG
PEF-R04 CAAGCTTGCATGCCTGCAGGTCGACTCTAGATTAGCGTTCAAACGGCAGAAT
rpoS-fw GGGTCGCGGATCCGAATTCATCACTGGCGGAAATGCCATTAC
rpoS-rev TTGTCGACCATATGGGATCCTGCGTATGGGCGGTAATTTGAC
katE-fw GCTCTAAGGAGGTTATAAAAAATGTCGCAACATAACGAAAAG
katE-rev GAGGATGCGTCATCGCCATTTCAGGCAGGAATTTTGTCAATC