Skip to main content

Advertisement

Table 1 Strains, plasmids, gene and primers

From: In vivo imaging of Lactococcus lactis, Lactobacillus plantarum and Escherichia coli expressing infrared fluorescent protein in mice

Bacteria, plasmid, or gene Relevant features or sequence (5′–3′) References or sources
Bacteria
 E. coli DH5α endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR F- Φ80dlacZΔM15 Δ(lacZYA-argF)U169, hsdR17(rK- mK +), λ– Invitrogen
 L. lactis NZ9000 MG1363 nisRK ΔpepN NIZO [35, 36]
 Lb. plantarum ATCC 8014 Wild type ATCC
Plasmid
 pNZ8148 pSH71 derivative, PnisA, CmR, nisin-controlled expression NIZO [35, 36]
 pNZRK pNZ8148 containing nisR and nisK genes This work
 pNZ-IRFP713 pNZ8148 containing irfp713 gene This work
 pNZ-IRFP682 pNZ8148 containing irfp682 gene This work
 pNZRK-IRFP713 pNZ8148 containing irfp713, nisR and nisK genes This work
 pMA-T-IRFP713 pMA-T containing irfp713 gene This work
 pMSP3545 Emr, P nisA , nisRK, NcoI for translational fusion, ColE1 and pAMβ1 replicons [37]
 pMSP3545-IRFP713 pMSP3545 containing irfp713 gene This work
 pGEM::CP25-IRFP pGEM-T Easy containing irfp713 gene under the control of CP25 promoter [27]
Gene
 irfp713 CCATGGCTGAGGGATCTGTAGCTCGTCAACCTGATTTACTTACTTGTGACGATGAACCTATTCATATTCCAGGTGCTATTCAACCACACGGACTTTTATTAGCTCTTGCCGCTGACATGACTATCGTCGCTGGATCAGATAATTTACCTGAATTGACTGGTTTAGCAATTGGAGCCCTTATTGGACGATCAGCAGCAGATGTTTTTGATTCAGAAACTCATAATCGTCTTACTATTGCATTGGCAGAACCTGGTGCTGCAGTAGGTGCTCCTATTACAGTAGGTTTCACTATGCGTAAGGATGCTGGTTTTATTGGTTCTTGGCATCGTCATGATCAACTTATTTTTTTAGAGTTGGAACCACCACAAAGAGACGTTGCAGAGCCTCAAGCTTTTTTTCGTCGTACTAATTCAGCAATTCGTAGACTTCAAGCTGCTGAAACTCTTGAATCTGCATGTGCAGCAGCAGCACAAGAGGTACGAAAAATTACAGGTTTTGATAGAGTTATGATTTACAGATTTGCCTCAGACTTTTCTGGTGAAGTAATCGCAGAGGATAGATGTGCCGAGGTTGAAAGTAAATTGGGATTGCATTATCCTGCCAGTACTGTTCCAGCCCAAGCACGTCGTCTTTATACTATTAATCCTGTTAGAATTATCCCAGATATTAATTATCGACCAGTTCCAGTTACTCCTGACTTAAATCCTGTAACTGGTAGACCTATTGACTTGTCATTTGCCATCTTACGATCTGTTTCACCTGTTCATTTAGAGTTTATGCGTAATATTGGTATGCATGGTACTATGTCTATCTCAATCCTTCGAGGAGAACGTTTATGGGGACTTATTGTTTGTCATCATAGAACACCTTATTATGTCGATTTAGATGGACGTCAAGCTTGTGAATTAGTTGCTCAAGTCTTGGCTTGGCAAATTGGTGTAATGGAAGAATAATCTAGA This work
Primers
 nisR-F GATGATAAGCTGTCCAAAC This work
 nisK-R TTTAGGATAACTTCTGCCC This work
 682-1F CTCAGACTTTTCTGGTGTAGTAATCGCAGAGGATAG This work
 682-2F GCATTATCCTGCCAGTGCTGTTCCAGCCCAAGC This work
 682-3F CCATCTTACGATCTGTTTCACCTTGTCATTTAGAGTTTATGCG This work
 682-1R CTATCCTCTGCGATTACTACACCAGAAAAGTCTGAG This work
 682-2R GCTTGGGCTGGAACAGCACTGGCAGGATAATGC This work
 682-3R CGCATAAACTCTAAATGACAAGGTGAAACAGATCGTAAGATGG This work