Skip to main content

Advertisement

Table 4 The sequences of the oligonucleotide primers used in this study

From: Impact of an energy-conserving strategy on succinate production under weak acidic and anaerobic conditions in Enterobacter aerogenes

Primer Primer sequences (5′–3′)
Disruption of poxB, pflB, ptsG, and ptsI genes
 ΔpoxB-attL 5′-ACGTAACCTGTAGTTTCATCTAAGCTTGATAGCGTTATCACAAAAAGGAGATGGAAAACCTGAAGCCTGCTTTTTTATACTAAGTTGGC-3′
 ΔpoxB-attR 5′-TATCACTGCGAAGATCTATCACGGCATATCCTTGTTCTGATTCAGGGTGATAGCATTGTTTACTCAGCCTTATTTTTCAGATTTTATTCGG-3′
 ΔpflB-attL 5′-CATTAATGGTTGTCTCAGGCAGTAAATAAAAAATCCACTTAAGAAGGTAGGTGT TACATGTGAAGCCTGCTTTTTTATACTAAGTTGGC-3′
 ΔpflB-attR 5′-AAAAAGGCCCCACTGATGTGGGGCCTTTATTGTACGCTTTTTCAGTCAGACAG GGAATTACGCTCAAGTTAGTATAAAAAAGCTGAACGA-3′
 ΔptsG-attL 5′-ATGTTTAAGAATGCATTTGCTAACCTGCAGAAGGTCGGTAAATCGCTGATGCTGCCAGTATGAAGCCTGCTTTTTTATACTAAGTTGGC-3′
 ΔptsG-attR 5′-TTAGCTATTGCGGATGTACTCATCCATCTCGGTTTTCAGGTTATCGGACTTGGTGCCGAACGCTCAAGTTAGTATAAAAAAGCTGAACGAG-3′
 ΔptsI-attL 5′-TGAACTCGAGTAAGTTCACGGGTTCTTTTTAATATCAGTCACAAGTAAGGTAGGGTTATGTGAAGCCTGCTTTTTTATACTAAGTTGGC-3′
 ΔptsI-attR 5′-ATCGAACAAACCCATGATCTTCTCCTAAGCAGTAATTTGGGCCGCGCATCTCGTGGATTACGCTCAAGTTAGTATAAAAAAGCTGAACGA-3′
 ΔpoxB-CF 5′-GTCGATTAGCTTATGTAGACCG-3′
 ΔpoxB-CR 5′-TGGAGTTCATTGACGGTTGGG-3′
 ΔpflB-CF 5′-GGCTTTGAACACAGCATCGC-3′
 ΔpflB-CR 5′-CTGTTTTGACAGGTACCC-3′
 ΔptsG-CF 5′-TGAATGAAACGTGATAGCCG-3′
 ΔptsG-CR 5′-TCAACTATAGACTTAGCTGC-3′
 ΔptsI-CF 5′-CAAGAAGTTACCATTACCGC-3′
 ΔptsI-CR 5′-TTGCCAGTAGGTTTGATGGC-3′
 frdABCD-CF 5′-GCGGCGATATTACATCCTGA-3′
 frdABCD-CR 5′-TCTAAGTGTAGATAGCGGCA-3′
A. succinogenes PCK expression cassette
 pck-tacR 5′-CGAGTTTGTTTAAGTCAGTCATGGCAGTCTCCTTGTGTGAAATTGTTATCCG-3′
 tac-pckF 5′-CGGATAACAATTTCACACAAGGAGACTGCCATGACTGACTTAAACAAACTCG-3′
 ΔpoxB-pckR 5′-TATCACTGCGAAGATCTATCACGGCATATCCTTGTTCTGATTCAGGGTGATAGCATTGTTATCTCAGCCTTATTTTTCAGATTTTATTCGG-3′
Promoter replacement of frdABCD
 frdABCD-tacF 5′-AAATAAAATTGATAAATTAGCGCACGGATTGATAAAAAAATCGAACGCGTTGAAGCCTGCTTTTTTATACTAAGTTGGCA-3′
 frdABCD-tacR 5′-CCTGCTCCGCCTGCGCCAATGACGACAAGATCGGCTTGAAAAGTTTGCACGGCAGTCTCCTTGTGTGAAATTGTTATCCG-3′