Skip to main content

Advertisement

Table 2 Bacterial strains, plasmids and oligonucleotides used in this study

From: Development of Pgrac100-based expression vectors allowing high protein production levels in Bacillus subtilis and relatively low basal expression in Escherichia coli

Bacterial strains Genotype Source/reference
E. coli OmniMAX mcrA Δ(mrr hsdRMS-mcrBC); resistant to T1 and T5 phage; used for cloning Invitrogen
B. subtilis 1012 leuA8 metB5 trpC2 hsrM1 [22]
Plasmid Description Source/reference
pHCMC04-bgaB PxylA-bgaB [9]
pHCMC05-bgaB Pspac-bgaB [9]
pHT01 Pgrac01 (previously called Pgrac) [16]
pHT01-bgaB Pgrac01-bgaB [16]
pHT10-gfp+ Pgrac-gfp-Strep [16]
pHT100 Pgrac100-bgaB [11]
pHT100-gfp+ Pgrac100-gfp This study
pHT212 Pgrac212-bgaB [17]
pHT253 Pgrac100-8xHis-MCS (Start codon-His-tag-BamHI-XbaI-AatII-SmaI) This study
pHT254 Pgrac100-MCS-His (BamHI-start codon-XbaI-AatII-His-tag-stop codon/TAA) This study
pHT255 Pgrac100-MCS-Strep (BamHI-start codon-XbaI-AatII-Strep-tag-stop codon/TAA) This study
pHT1169 Pgrac100-His-gfp This study
pHT1170 Pgrac100-gfp-His From Nguyen H. N
pHT1171 Pgrac100-gfp-Strep This study
pHT1178 Pgrac100-8xHis-bgaB From Nguyen H. N
pHT1179 Pgrac100-bgaB-His This study
pHT1180 Pgrac100-bgaB-Strep This study
a Oligonucleotide Sequence 5′ → 3′ Used for
ON301F GATCTATGGAAGCTCATCACCATCACCATCACCATCACGGATCCATGTCTAGAGTCGACGT pHT253
ON302R CGACTCTAGACATGGATCCGTGATGGTGATGGTGATGGTGATGAGCTTCCATA pHT253
ON303F GATCCATGTCTAGAGTCGACGTCGCTCATCACCATCACCATCACCATCACTAACGT pHT254
ON304R TAGTGATGGTGATGGTGATGGTGATGAGCGACGTCGACTCTAGACATG pHT254
ON305F GATCCATGTCTAGAGTCGACGTCGCTTGGAGCCATCCGCAATTTGAAAAATAACGT pHT255
ON306R TATTTTTCAAATTGCGGATGGCTCCAAGCGACGTCGACTCTAGACATG pHT255
ON941 AAAGGAGGAAGGATCCATGAATGTGTTATC pHT1179 and pHT1180
ON1250 CTGCCCCGGGGACGTCAACCTTCCCGGCTTCATCATGC pHT1179 and pHT1180
ON1277 AAAGGAGGAAGGATCCATGGCTAGCAAAGGAGAAGAACT pHT1169 and pHT1171
ON1278 GGCCATGACGTCTTTGTAAAGCTCATCCATGCCATGTGT pHT1171
ON1279 CCAGGTCTCAGATCTATGGCTAGCAAAGGAGAAGAACT pHT100-gfp+
ON1280 GGCCATGACGTCTTATTTGTAAAGCTCATCCATGCCATGTGT pHT100-gfp + and pHT1169
  1. aThe restriction sites used for plasmid construction are underlined. Pgrac01 (another name is Pgrac), Pgrac100 and Pgrac212 are the name of different promoters; MCS, multi-cloning site; Strep, Strep-tag; His, His-tag