Skip to main content


Table 3 List of primers used

From: Iterative carotenogenic screens identify combinations of yeast gene deletions that enhance sclareol production

ROX1-pUG F primer ttatacatttacggtgtcttaactctccctcttcacccctcattattccagaacagctgaagcttcgtacgc
ROX1-pUG R primer caggagccaaatgcataaatttttagttaaagggaatatagtataatataatgcataggccactagtggatctg
ROX1prom gctctatcttatttgctaattgtagtttc
DOS2 Out pUG F gccttacatcaaatagcggtgattaatgataaaaagcacttagcagaagtcatgcacagctgaagcttcgtacgc
DOS2 OutR pUGR atcacgcccagattttgtcttcctcctgtgcatctcttggattgatgattttcgcataggccactagtggatctg
DOS2prom ctgggtattcatagcaattgtgaacccata
VBA5-pUG F atgatacgagtcgacaaaatatgcaaaagataatagtgtcatcacacctttatgacagctgaagcttcgtacgc
VBA5-pUG R gaaattacattccattgcgatacacctatttgattctgattgtgttgaagtctgtagcataggccactagtggatctg
VBA5prom agtaggtgaaagttaacatgcgagt
YER134c pUG F aagagaacaattttgttacaaatcctgctccaaaatagtctcaacgcgtttattcagctgaagcttcgtacgc
YER134c pUG R tgacttcttcttatgctcagatgatgctctgtgaactaagtgcgcagtccttcagcataggccactagtggatctg
YER134c prom tttcacgcactagaagaaggacct
YNR063w pUG F ctgtgtctgttctctttgatgctgtcatctaagattcaattaaagtcgaccacagctgaagcttcgtacgc
YNR063w pUG R ctaccatgtcatatggatctttcccctagtaaacttgtatctcaaaaggtcagcataggccactagtggatctg
YNR063w prom ggtctattaggctctttactttgtaag
YGR259c pUG F caggtcaaacagatactcatcattaatggcggacccataattttcagaaggttcagctgaagcttcgtacgc
YGR259c pUG R tcttagaagtcgtattcacatcacagttttccccctcttcgcctttttcaaactagcataggccactagtggatctg
YGR259c prom agcgaacctcagagcatattgttctc