Skip to main content

Table 2 Oligonucleotides used in this study

From: An analysis of the changes in soluble hydrogenase and global gene expression in Cupriavidus necator (Ralstonia eutropha) H16 grown in heterotrophic diauxic batch culture

Primer Sequence Notes
hoxF_fwd CTGTTCGACACCCCCTGTAT HoxF (NAD-reducing hydrogenase diaphorase moiety large subunit)
hoxF_rev ATAGGCGATGTCCTGACTGG
hypF2_fwd CAACACCCTGGATCTGCTG HypF2
hypF2_rev GAGGATGTGGTTGAGGAAGC
hoxA_fwd CCGATTCGGAAGACATCATT HoxA (a transcriptional activator (NtrC family) of hydrogenase genes)
hoxA_rev AACTCGAGATCAAGGCGATG
gyrB_fwd GCCTGCACCACCTTGTCTTC DNA gyrase subunit B
gyrB_rev TGTGGATGGTGACCTGGATCT