Skip to main content

Table 1 Strains, plasmids and primers used in this study

From: Microbial host selection affects intracellular localization and activity of alcohol-O-acetyltransferase

Name Description Source
Strains   
E. coli BL21(DE3) F– ompT gal dcm lon hsdSB(rB- mB-) λ(DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5]) New England Biolabs
E. coli BL21(DE3)-RIL plus F– ompT hsdS(rB– mB–) dcm + Tetr gal λ(DE3) endA Hte [argU ileY leuW Camr] Agilent Technologies
S. cerevisiae BY4742 MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 GE Healthcare
Plasmids   
pGFP pET-28b(+) derivative with gfp insertion This study
pATF1G pET-28b(+) derivative with atf1(S.c)-gfp insertion This study
pATF2G pET-28b(+) derivative with atf2(S.c)-gfp insertion This study
pSPG pET-28b(+) derivative with atf(S.p)-gfp insertion This study
pKLG pET-28b(+) derivative with atf(K.l)-gfp insertion This study
pPAG pET-28b(+) derivative with atf(P.a)-gfp insertion This study
pSLG pET-28b(+) derivative with atf(S.l)-gfp insertion This study
pYPGK pRS426 derivative; PGK1p-PGK1t [19]
pYATF1G pYPGK derivative with atf1(S.c)-gfp insertion [19]
pYATF2G pYPGK derivative with atf2(S.c)-gfp insertion [19]
pYSPG pYPGK derivative with atf(S.p)-gfp insertion [19]
pYKLG pYPGK derivative with atf(K.l)-gfp insertion [19]
pYPAG pYPGK derivative with atf(P.a)-gfp insertion [19]
pYSLG pYPGK derivative with atf(S.l)-gfp insertion [19]
Primers   
gfp 5'GCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGCTAGCATGACTGGTG3' This study
  5'CCGCTCGAGTTATTTGTATAGTTCATCCATGCCATG3' This study
atf1-S.c-gfp 5'GCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGAATGAAATCGATGAGAAAAATCAG3' This study
  5'CCGCTCGAGTTATTTGTATAGTTCATCCATGCCATG3' This study
atf2-S.c-gfp 5'GCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGAAGATATAGAAGGATACGAACCACATATCACTC3' This study
  5'ACGCGTCGACTTATTTGTATAGTTCATCCATGCCATG3' This study
atf-S.p-gfp 5'GCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGAAACAGAAGAAAGCCAATTTAGCAGTATAAC3' This study
  5'CCGCTCGAGTTATTTGTATAGTTCATCCATGCCATG3' This study
atf-K.l-gfp 5'GCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGGTTCGGTGTGTTTATCATCAAAAAAGTTAG3' This study
  5'CCGCTCGAGTTATTTGTATAGTTCATCCATGCCATG3' This study
atf-P.a-gfp 5'GCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGTTGTTAAATTCAAAAGCAAAATCAATAACAAAGG3' This study
  5'CCGCTCGAGTTATTTGTATAGTTCATCCATGCCATG3' This study
atf-S.l-gfp 5'GCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGCTAATATTTTGCCAATTTC3' This study
  5'CCGCTCGAGTTATTTGTATAGTTCATCCATGCCATG3' This study