Skip to main content

Table 4 Sequences of primers for qPCR

From: Exchange of single amino acids at different positions of a recombinant protein affects metabolic burden in Escherichia coli

Target Primers (5′ → 3′) a Length (nt) Primer position Product size (bp)
Bla F: AGTTCTGTCTCGGCGCGTCT 20 1331-1350 96
  R: ACTCCAGTCGCCTTCCCGTT 20 1426-1445  
T7 RNApol F: AGGACTGCTTACGCTGGCGA 20 1488-1507 116
  R: TGATGCGCTCAGGGAACGGA 20 1603-1622  
  1. aF and R indicate forward and reverse primers, respectively.