Skip to main content

Table 4 Strains, plasmids and oligonucleotides used in this study

From: Role of L-alanine for redox self-sufficient amination of alcohols

Strains Relevant characteristics Reference
E. coli DH5α F thi-1 endA1 hsdr17(r, m) supE44 ΔlacU169 [19]
(ɸ80lacZΔM15) recA1 gyrA96 relA1
E. coli W3110 F λ INV(rrnD – rrnE)1 [19]
E. coli MG1655 F λ ilvG- rfb-50 rph-1 [19]
E. coli YYC202 ΔaceEF pfl1 poxB1 pps4 rpsL zbi::Tn10 [8]
E. coli BW25113 lacI q rrnB T14 lacZ WJ16 hsdR514 araBA-D AH33 rhaBAD LD78 [20]
W3110/pTrc99A-ald-adh-ta Vf E. coli W3110 harboring pTrc99A-ald-adh-ta with the transaminase of Vibrio fluvialis [6]
W3110/pTrc99A-ald-adh-ta Cv E. coli W3110 harboring pTrc99A-ald-adh-ta with the transaminase of Chromobacterium violaceum This study
MG1655/pTrc99A-ald-adh-ta Cv E. coli MG1655 harboring pTrc99A-ald-adh-ta with the transaminase of Chromobacterium violaceum This study
YCC202/pTrc99A-ald-adh-ta Cv E. coli YCC202 harboring pTrc99A-ald-adh-ta with the transaminase of Chromobacterium violaceum This study
BW25113/pTrc99A-ald-adh-ta Cv E. coli BW25113 harboring pTrc99A-ald-adh-ta with the transaminase of Chromobacterium violaceum This study
JW0855-1/pTrc99A-ald-adh-ta Cv (BW25113ΔpoxB::kan) F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ , ΔpoxB772::kan, rph-1, Δ(rhaD-rhaB)568, hsdR514; harboring the plasmid pTrc99A-ald-adh-ta with the transaminase of Chromobacterium violaceum [20]/Transformation in this study
JW2293-1/pTrc99A-ald-adh-ta Cv (BW25113ΔackA::kan) F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ , ΔackA778::kan, rph-1, Δ(rhaD-rhaB)568, hsdR514; harboring the plasmid pTrc99A-ald-adh-ta with the transaminase of Chromobacterium violaceum [20]/Transformation in this study
JW2294-1/pTrc99A-ald-adh-ta Cv (BW25113Δpta::kan) F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ , Δpta779::kan, rph-1, Δ(rhaD-rhaB)568, hsdR514; harboring the plasmid pTrc99A-ald-adh-ta with the transaminase of Chromobacterium violaceum [20]/Transformation in this study
Plasmids Relevant characteristics Reference
pTrc99A-ta Vf pTrc99A carrying ta of Vibrio fluvialis This study
pTrc99A-ta Cv pTrc99A carrying ta of Chromobacterium fluvialis This study
pTrc99A-ald-adh-ta Vf pTrc99A carrying ald-adh-ta Vf synthetic operon [6]
ald from B. subtilis 168
adh from B. stearothermophilus
ta from V. fluvialis
pTrc99A-ald-adh-ta Vf_mut pTrc99A-ald-adh-ta Vf with BamHI cut site upstream of ta Vf This study
pTrc99A-ald-adh-ta Cv pTrc99A carrying ald-adh-ta Cv synthetic operon This study
ald from B. subtilis 168
adh from B. stearothermophilus
ta from C. violaceum
Oligonucleotides Sequence 5′→ 3′ Use
taVf_RBS_for CAGACCATGGAATTCGAGCAGGAAACAGACCATGAACAAACCGCAGAGCTG pTrc99A-ta Vf
taVf_rev ATCCCCGGGTACCGAGTTACGCAACTTCCGCGAAAAC pTrc99A-ta Vf
taCv_KpnIRBS_for CAAGGTACCCAGGAAACAGACCATGCAGAAACAGCGTACCACC pTrc99A-ta Cv
taCv_BamHI_rev GTTGGATCCTTAGGCCAGACCACGTGCTTTC pTrc99A-ta Cv
pTrc99a-ald-adh-taVf_mut_for GGAAGATAAATAAGGATCCCAGGAAACAGACCATGAAC pTrc99A-ald-adh-ta Cv
pTrc99a-ald-adh-taVf_mut_rev CTGGGATCCTTATTTATCTTCCAGGGTCAGAACAACA pTrc99A-ald-adh-ta Cv
pTrc99a-ald-adh-taCv _for CAAGGATCCCAGGAAACAGACCATGCAGAAACAGCGTACCACC pTrc99A-ald-adh-ta Cv
pTrc99a-ald-adh-taCv _rev GTTGGATCCTTAGGCCAGACCACGTGCTT pTrc99A-ald-adh-ta Cv