From: Role of L-alanine for redox self-sufficient amination of alcohols
Strains | Relevant characteristics | Reference |
---|---|---|
E. coli DH5α | F− thi-1 endA1 hsdr17(r−, m−) supE44 ΔlacU169 | [19] |
(ɸ80lacZΔM15) recA1 gyrA96 relA1 | ||
E. coli W3110 | F− λ− INV(rrnD – rrnE)1 | [19] |
E. coli MG1655 | F− λ− ilvG- rfb-50 rph-1 | [19] |
E. coli YYC202 | ΔaceEF pfl1 poxB1 pps4 rpsL zbi::Tn10 | [8] |
E. coli BW25113 | lacI q rrnB T14 lacZ WJ16 hsdR514 araBA-D AH33 rhaBAD LD78 | [20] |
W3110/pTrc99A-ald-adh-ta Vf | E. coli W3110 harboring pTrc99A-ald-adh-ta with the transaminase of Vibrio fluvialis | [6] |
W3110/pTrc99A-ald-adh-ta Cv | E. coli W3110 harboring pTrc99A-ald-adh-ta with the transaminase of Chromobacterium violaceum | This study |
MG1655/pTrc99A-ald-adh-ta Cv | E. coli MG1655 harboring pTrc99A-ald-adh-ta with the transaminase of Chromobacterium violaceum | This study |
YCC202/pTrc99A-ald-adh-ta Cv | E. coli YCC202 harboring pTrc99A-ald-adh-ta with the transaminase of Chromobacterium violaceum | This study |
BW25113/pTrc99A-ald-adh-ta Cv | E. coli BW25113 harboring pTrc99A-ald-adh-ta with the transaminase of Chromobacterium violaceum | This study |
JW0855-1/pTrc99A-ald-adh-ta Cv (BW25113ΔpoxB::kan) | F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ −, ΔpoxB772::kan, rph-1, Δ(rhaD-rhaB)568, hsdR514; harboring the plasmid pTrc99A-ald-adh-ta with the transaminase of Chromobacterium violaceum | [20]/Transformation in this study |
JW2293-1/pTrc99A-ald-adh-ta Cv (BW25113ΔackA::kan) | F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ −, ΔackA778::kan, rph-1, Δ(rhaD-rhaB)568, hsdR514; harboring the plasmid pTrc99A-ald-adh-ta with the transaminase of Chromobacterium violaceum | [20]/Transformation in this study |
JW2294-1/pTrc99A-ald-adh-ta Cv (BW25113Δpta::kan) | F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ −, Δpta779::kan, rph-1, Δ(rhaD-rhaB)568, hsdR514; harboring the plasmid pTrc99A-ald-adh-ta with the transaminase of Chromobacterium violaceum | [20]/Transformation in this study |
Plasmids | Relevant characteristics | Reference |
pTrc99A-ta Vf | pTrc99A carrying ta of Vibrio fluvialis | This study |
pTrc99A-ta Cv | pTrc99A carrying ta of Chromobacterium fluvialis | This study |
pTrc99A-ald-adh-ta Vf | pTrc99A carrying ald-adh-ta Vf synthetic operon | [6] |
ald from B. subtilis 168 | ||
adh from B. stearothermophilus | ||
ta from V. fluvialis | ||
pTrc99A-ald-adh-ta Vf_mut | pTrc99A-ald-adh-ta Vf with BamHI cut site upstream of ta Vf | This study |
pTrc99A-ald-adh-ta Cv | pTrc99A carrying ald-adh-ta Cv synthetic operon | This study |
ald from B. subtilis 168 | ||
adh from B. stearothermophilus | ||
ta from C. violaceum | ||
Oligonucleotides | Sequence 5′→ 3′ | Use |
taVf_RBS_for | CAGACCATGGAATTCGAGCAGGAAACAGACCATGAACAAACCGCAGAGCTG | pTrc99A-ta Vf |
taVf_rev | ATCCCCGGGTACCGAGTTACGCAACTTCCGCGAAAAC | pTrc99A-ta Vf |
taCv_KpnIRBS_for | CAAGGTACCCAGGAAACAGACCATGCAGAAACAGCGTACCACC | pTrc99A-ta Cv |
taCv_BamHI_rev | GTTGGATCCTTAGGCCAGACCACGTGCTTTC | pTrc99A-ta Cv |
pTrc99a-ald-adh-taVf_mut_for | GGAAGATAAATAAGGATCCCAGGAAACAGACCATGAAC | pTrc99A-ald-adh-ta Cv |
pTrc99a-ald-adh-taVf_mut_rev | CTGGGATCCTTATTTATCTTCCAGGGTCAGAACAACA | pTrc99A-ald-adh-ta Cv |
pTrc99a-ald-adh-taCv _for | CAAGGATCCCAGGAAACAGACCATGCAGAAACAGCGTACCACC | pTrc99A-ald-adh-ta Cv |
pTrc99a-ald-adh-taCv _rev | GTTGGATCCTTAGGCCAGACCACGTGCTT | pTrc99A-ald-adh-ta Cv |