Strain, plasmid, primer, or transformant | Relevant features | Source or reference |
---|---|---|
Strains | Â | Â |
Escherichia coli | Â | Â |
Nova blue | endA1 hsdR17(r K12 -m K12 +) supE44 thi-I gyrA96 relA1 lac recA1/F’[proAB+ lacIq ZΔM15::Tn10(Tetr)] | Novagen |
S17-1 λpir | TpR SmR recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpir | BIOMEDAL |
BL21 (DE3) pLysS | F– ompT hsdS(r B – m B – ) gal dcm λ(DE3) pLysS (Camr) (λ(DE3): lacI,lacUV5-T7 gene 1,ind1,sam7,nin5) | TAKARA BIO |
Streptomyces lividans | Â | Â |
Streptomyces lividans 1326 | WT strain (NBRC 15675) | NBRC |
Plasmids | Â | Â |
pTONA4 | Versatile vector for protein expression in Streptomyces; thiostrepton and kanamycin resistance marker | [24] |
pUC702-pro-sig-term | Versatile vector for protein expression; thiostrepton resistance marker | [16] |
pUC702-ps-Savcore | Vector for Sav (core) expression; thiostrepton resistance marker | This study |
pUC702-ps-Savnat | Vector for Sav (native) expression; thiostrepton resistance marker | This study |
pTONA4-Savnat | Vector for Sav (native) expression; thiostrepton and kanamycin resistance marker | This study |
pTONA4-ps-Savnat | Vector for Sav (native) expression; thiostrepton and kanamycin resistance marker | This study |
pTONA4-Savcore | Vector for Sav (core) expression; thiostrepton and kanamycin resistance marker | This study |
pTONA4-SavΔC | Vector for Sav-ΔC expression; thiostrepton and kanamycin resistance marker | This study |
pTONA4-SavΔN | Vector for Sav-ΔN expression; thiostrepton and kanamycin resistance marker | This study |
pWI3SAFlo318 | Vector used as a template for amplifying the synthetic gene of streptavidin | [25] |
pColdI | Versatile vector for protein expression in E. coli; ampicillin resistance marker | TAKARA BIO |
pColdI-Sav | Vector for Sav expression; ampicillin resistance marker | This study |
Transformants | Â | Â |
S. lividans/Savnat | S. lividans transformant harboring pTONA4-Savnat | This study |
S. lividans/Savcore | S. lividans transformant harboring pTONA4- Savcore | This study |
S. lividans/psSavnat | S. lividans transformant harboring pTONA4-ps-Savnat | This study |
S. lividans/SavΔC | S. lividans transformant harboring pTONA4- SavΔC | This study |
S. lividans/SavΔN | S. lividans transformant harboring pTONA4- SavΔN | This study |
E. coli/SavEco | E. coli transformant harboring pColdI-Sav | This study |
Oligonucleotide primers | Â | Â |
Sav_F | TCGTTTAAGGATGCAatgcgcaagatcgtcgttgca | Â |
Sav_R | CGCTCAGTCGTCTCAgtggtggtggtggtggtgctgctgaacggcgtcgagcgggtt | Â |
SavΔN_F | GCCAGCGCTTCGGCAgaggccggcatcaccggcacctgg |  |
SavΔC_R | CGCTCAGTCGTCTCAgtggtggtggtggtggtgggaggcggcggacggcttca |  |
Sav-sig_F | TCGTTTAAGGATGCAatgcgcaagatcgtcgttgcagccatcgccgtttccctgaccacggtctcgattacggccagcgcttcggca | Â |
Sav-sig_R | tgccgaagcgctggccgtaatcgagaccgtggtcagggaaacggcgatggctgcaacgacgatcttgcgcatTGCATCCTTAAACGA | Â |
SavΔN_to_ps_F | GCGGCTCCGGCCTTCgaggccggcatcaccggcacctgg |  |
Sav_os_to_ps_F | GCGGCTCCGGCCTTCatgcgcaagatcgtcgttgca | Â |
ps_F | TCGTTTAAGGATGCAGCATGCTCCGCCACCGGCTCCGCCG | Â |
Kpn1_Xho1_Stav_F | GGGGTACCCTCGAGGCCGAGGCCGGCATCACCGGCACCTGG | Â |
Stav_TAG_BamH1_EcoR1_R | GGAATTCGGATCCCGCTAGGAGGCGGCGGACGGCTTCACCTTGGTGAAGGT | Â |