Skip to main content

Table 2 Primers and PCR conditions used for TRFLP and amplification of surfactin and iturin from Bacillus sp. strain RMB7

From: Genetic, physiological and biochemical characterization of Bacillussp. strain RMB7 exhibiting plant growth promoting and broad spectrum antifungal activities

Gene/Antibiotic Primer Primer sequence (5’-3’) PCR profile (30 cycles each) Reference
16S rRNA fD1rD1 AGAGTTTGATCCTGGCTCAG Denaturing: 95’C 2 min. [51]
Annealing: 55’C 30 sec.
AAGGAGGTGATCCAGCC
Extension: 72 °C 5’min.
Surfactin Sfp-f ATG AAG ATTTACGGAATTTA Denaturing: 94 °C 1 min. [52]
Annealing: 48 °C 1 min.
Sfp-r TTATAAAAGCTCTTCGTACG
Extension: 72 °C 1 min.
Iturin A ituD-f ATG AAC ATCTTGCCTTTTTA Denaturing: 94 °C 1 min. [53]
Annealing: 50 °C 1 min.
ituD-r TTATTTTAAAATCCGCAATT
Extension: 72 °C 1.5’min.
TRFLP-16S rDNA VIC-63’F CAGGCCTAACACATGCAAGTC Denaturing: 94 °C 30 Sec. [53],[54]
Annealing: 56 °C 30 Sec.
FAM-1389R ACGGGCGGTGTGTACAAG
Extension: 72 °C 2 min.
TRFLP-Fungal ITS FAM -ITS1 TCCGTAGGTGAACCTTGCGG Denaturing: 94 °C 30 Sec. [55]
Annealing: 55’C 30 Sec.
VIC- ITS4 TCCTCCGCTTATTGATATGC
Extension: 72 °C 30 Sec.