Skip to main content

Table 2 Primers used in this study

From: MEP pathway-mediated isopentenol production in metabolically engineered Escherichia coli

Name Sequence (5′-3′) Function
Dxs-F CGTCGGATCCATGAGTTTTGATATTGCCA For PCR amplification of dxs
Dxs-R CGGGAATTCTTATGCCAGCCAGGCCTTG
IspG-F CACGAGCTCAGGAGATATACCATGCATAACCAGGCTCCAAT For PCR amplification of ispG
IspG-R CGTGAGCTCTTATTTTTCAACCTGCTGAACGT
Eddp1-KF TCTGCGCTTATCCTTTATGGTTATTTTACCGGTAACATGACATATGAATATCCTCCTTAGT For PCR amplification of eddp1 replacement cassette
Eddp1-KF CAATGATTCGATTTGTTACGCGTAACAATTGTGGATTCATTGTTTATTCCTCCTTACATTATACGAGCCGGATGATTAATTGTCAAGTGTAGGCTGGAGCTGCTTCG
TrcIN-F GTGGCGATGATTACCCGTGA For verification of eddp1 replacement with pTrc
TrcIN-R GGTTACCGCATGCCAACTGC
Pgi-KF CTTCTCAGAAGCGATTATTTCCGGTGAGTGGAAAGGTTATCATATGAATATCCTCCTTAGT For PCR amplification of pgi disruption cassette
Pgi-KR TACCGTTACGGTCAACATACTTACCGTTGGACTCCATATTGTGTAGGCTGGAGCTGCTTCG
Pgi-F TACTCCAAAAACCGCATCAC For verification of pgi disruption
Pgi-R CGAAGAAGTTAGACAGCAGT