Skip to main content

Table 3 Primers used in this study

From: Two distinct regions in the model protein Peb1 are critical for its heterologous transport out of Escherichia coli

Primer Application Sequence 5'-3'
Peb1RXbaI PCR GGCTCTAGATTATAAACCCCATTTTTTCGC
5'UTRfwBglII PCR GCCAGATCTGCGGGAATAAGGGGCAGAG
K1012R PCR GGTCTAGATTAACCCTGCAGCAGAGACA
FliC183XbaIR PCR GGTCTAGATTAAGTGGTAACTGTATCGTTAT
K1008OF PCR GGCGATCGGCGGGAATAAGGGGCAGAG
ORpLA15 PCR GCCGCATGCCGATAAACAGCCCTGCGTTA
pBRAhdIF Sequencing GCCTTCGTTCATCCATAGTTGCCT
pLA21R Sequencing GCCCAGTTAATCAGGTTACAACGATT
NotI mini Sequencing TGCGGCCGCA
028R Sequencing CAATTCAACTTGTAGGCCTGATA
peb1/pLA25FIN Construction of: pLA32 GATCACTCAAAATAATATCAACAAGGCAGAAGGTAAACTTGAGTC
peb1/pLA25RIN pLA32 GACTCAAGTTTACCTTCTGCCTTGTTGATATTATTTTGAGTGATC
HotNIF pTAR1P TAGCTGTTGCCGCATTGCTAGCTGCAAGTATATTGGGTG
HotNIR pTAR1P GCAATGCGGCAACAGCTACTGCGAAACCTTTAATTTCAC
HotCIF pTAR2P CGTTTGCTGTAGCCGCAGCAATATTGTTAGGTTATGTGG
HotCIR pTAR2P ATATTGCTGCGGCTACAGCAAACGCATCAACTCTTTTAG
PebGlyF pTAR15G GGCGGTGGTGGGGGCGTTGCCAAATTGCTAGCTAAAAG
PebGlyR pTAR15G GCCCCCACCACCGCCATCTACTTCGAAACCTTTAATTTC
PebAla1F pTAR1A GCAGCAGCGGCGGCCGCAGCGCTAGCTAAAAGTATATTGGGTG
PebAla1R pTAR1A CGCTGCGGCCGCCGCTGCTGCGAAACCTTTAATTTCACCTGTTG
PebGly1F pTAR1G GGCGGCGGTGGTGGCGGTGGCCTAGCTAAAAGTATATTGGGTG
PebGly1R pTAR1G GCCACCGCCACCACCGCCGCCGAAACCTTTAATTTCACCTGTTG
PebAla3F pTAR2A GCAGCCGCAGCAGCAGCGGCAGCGGCGGTGGATGATAAAAGTGAAATTTTG
PebAla3R pTAR2A CGCCGCTGCCGCTGCTGCTGCGGCTGCAGAAAACGCATCAACTCTTTTAG
PebGly3F pTAR2G GGCGGCGGTGGTGGCGGGGGCGGTGGTGTGGATGATAAAAGTGAAATTTTG
PebGly3R pTAR2G ACCACCGCCCCCGCCACCACCGCCGCCAGAAAACGCATCAACTCTTTTAG