Skip to main content

Table 1 E. coli strains, plasmids and oligonucleotides used

From: Biosynthesis of chiral 3-hydroxyvalerate from single propionate-unrelated carbon sources in metabolically engineered E. coli

Name Relevant Genotype Reference
Strains   
   DH10B F- mcr A Δ(mrr-hsd RMS-mcr BC) ϕ80lac ZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupG Invitrogen
   ElectroTen-Blue Δ(mcrA)183 Δ(mcrCB-hsdSMR-mrr)173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac Kanr [F' proAB lacIqZ ΔM15 Tn10 (Tetr)] Stratagene
   MG1655 F- λ- ilvG- rfb-50 rph-1 ATCC 700926
   HCT 10 MG1655 ΔendA ΔrecA (DE3) This study
   HCT 11 MG1655 ΔendA ΔrecA ΔatoB (DE3) This study
   HCT 20 MG1655 ΔendA ΔackA-pta ΔatoDA ΔpoxB (DE3) This study
   HCT 21 MG1655 ΔendA ΔackA-pta ΔatoDA ΔpoxB ΔmetA Δtdh (DE3) This study
Plasmids   
   pETDuet-1 ColE1(pBR322) ori, lacI, T7lac, AmpR Novagen
   pCDFDuet-1 CloDF13 ori, lacI, T7lac, StrepR Novagen
   pCOLADuet-1 COLA ori, lacI, T7lac, KanR Novagen
   pET-B pETDuet-1 harboring bktB from R. eutropha H16 This study
   pET-PB-B a pETDuet-1 harboring ptb-buk operon from C. acetobutylicum ATCC 824, and bktB from R. eutropha H16 This study
   pCDF-H pCDFDuet-1 harboring hbd from C. acetobutylicum ATCC 824 This study
   pCDF-T-H a pCDFDuet-1 harboring tesB from E. coli MG1655, and hbd from C. acetobutylicum ATCC 824 This study
   pCDF-P pCDFDuet-1 harboring phaB from R. eutropha H16 This study
   pCDF-T-P a pCDFDuet-1 harboring tesB from E. coli MG1655, and phaB from R. eutropha H16 This study
   pCOLA-Iec pCOLADuet-1 harboring ilvA from E. coli MG1655 This study
   pCOLA-Icg pCOLADuet-1 harboring ilvA from C. glutamicum This study
   pCOLA-Tec-Icg a pCOLADuet-1 harboring thrABC operon from E. coli MG1655, and ilvA from C. glutamicum ATCC 13032 This study
   pCOLA-Tecm-Icg a pCOLADuet-1 harboring thrAG1297ABC operon from E. coli ATCC 21277, and ilvA from C. glutamicum ATCC 13032 This study
Primers b Sequence 5'→3' c  
   bktB_US_EcoRI GAATTC ATGACGCGTGAAGTGGTAGTG Sigma-Genosys
   bktB_DS_XhoI CTCGAG CGCAAGGCTAACCTCAGAT Sigma-Genosys
   hbd_US_NdeI ATTCATATG AAAAAGGTATGTGTTATAGG Sigma-Genosys
   hbd_DS_AvrII ATTCCTAGG CAGGTCGACTCTAGAACTTA Sigma-Genosys
   phaB_US_MfeI ATTCAATTG ACGAAGCCAATCAAGGAG Sigma-Genosys
   phaB_DS_AvrII ATTCCTAGG GGTCAGCCCATATGCAG Sigma-Genosys
   tesB_US_NcoI ATTCCATGG GCATGAGTCAGGCGCTAA Sigma-Genosys
   tesB_DS_NotI ATTGCGGCCGCG ACTCTAGAGACTTAATTGTG Sigma-Genosys
   ilvAec_US_NdeI ATTACATATG GCTGACTCGCAAC Sigma-Genosys
   ilvAec_DS_AvrII ATTACCTAGG CATTTTTCCCTAACC Sigma-Genosys
   ilvAcg_US_NdeI ATTACATATG AGTGAAACATACGTGTC Sigma-Genosys
   ilvAcg_DS_AvrII ATTACCTAGG CCTTCAGCTATGTTTA Sigma-Genosys
   thrABC_US_BamHI ATTAGGATCC AAGGAGATATATCATGCGAGTGTTGAAG Sigma-Genosys
   thrABC_US_NcoI ATTACCATGG GCATGCGAGTGTTGAAG Sigma-Genosys
   thrABC_DS_SalI ATTAGTCGAC GATAATGAATAGATTTTACTGATG Sigma-Genosys
  1. a Each gene is under the control of the T7lac promoter with a ribosome binding site.
  2. b Primers were synthesized at Sigma-Genosys, St. Louis, MO.
  3. c Restriction enzyme sites used in the cloning are shown in underlined italics.