Skip to main content

Table 2 Genes and primers used for the amplification of DNA probes

From: Reduction of oxidative cellular damage by overexpression of the thioredoxin TRX2 gene improves yield and quality of wine yeast dry active biomass

Probe Primer Sequence (5'-3') Probe length (bp)
GRX2 GRX2-1 GTATCCCAGGAAACAGTTGC 945
  GRX2-2 GTTTCCAAATCGCTGTTACC  
GRX5 GRX5-1 CATAAGGTCATTTTCCCCC 407
  GRX5-2 CTTCTTCAGGTACCAATGCC  
TSA1 TSA1-1 CAAGTTCAAAAGCAAGCTCC 461
  TSA1-2 TCAACCAATCTCAAGGCTTC  
TRR1 TRR1-1 ATGAAGGTATGATGGCGAAC 779
  TRR1-2 ATCCTGAACATCACCAGCAG  
GSH1 GSH1-1 CCCGATGAAGTCATTAACA 945
  GSH1-2 GGAAAAGGTCAAAATGCT  
HGT1 HGT1-1 GGACAATCATCGGAAGCTG 817
  HGT1-2 GAGCTTGCAGGGTTGACGAC