Skip to main content

Table 7 List of strains, constructed plasmids, and primers used in this study

From: Physiological responses to folate overproduction in Lactobacillus plantarum WCFS1

Material Relevant features Source of reference
Strains   
L. lactis; NZ9000 MG1363 pepN:nisRK, Cloning host [44]
L. plantarum WCFS1 Cloning host, genomic DNA isolation [17]
L. plantarum NZ7100 WCFS1 :nisRK, Cloning host [46]
Plasmids   
pNZ7021 CmR, pNZ8148 derivative, nisin promoter replaced by pepN promoter [1]
pNZ7026 CmR, pNZ7021 derivative containing the folB, folP, folK, folE, xtp2 and folC2 gene cluster of L. plantarum WCFS1 [18]
pNZ8148 CmR, nisin regulated promotor [44]
pNZ7030 CmR, pNZ8148 derivative containing folB, folP, folK, folE, xtp2 and folC2 gene cluster of L. plantarum WCFS1 in the sense orientation (this study)
pNZ7031 CmR, pNZ8148 derivative containing folB, folP, folK, folE, xtp2 and folC2 gene cluster of L. plantarum WCFS1 in the antisense orientation (this study)
Primers   
LpfBnco-F CTGGGATACCCATGG GCATGATTC  
LpfPkpn-R CGTCAAAAGGTACC GGACTAATCATTATTCG  
pNis-F TAGTCTTATAACTATACTGAC  
LpfB-R CTTGCCATTCGGCGTCCCCTCCACCTCAATTTCC  
LpfBatg-F ATGGGCATGATTCGAATTAATAATTTACG  
LpfP-xbatest GAATTTAATTATTTGCGACGCCCAAT  
FQPCRfolBS CCTATCGAAACCAAGGTTCAACA  
RQPCRfolBS ACAAATTCATCGACCACGTTACG  
FQPCRfolBAS TCAACTTGTATGAATGGGTCGTTACA  
RQPCRfolBAS CGTTCACGAGACCATCAATTACG  
FQPCRFPS CATTATTAACGATGTGAACGCCTTT  
RQPCRFPS CGCGACTGTCAGCCATCAAT  
FQPCRfPAS CTAACAGCGTAATCAATTGCTTGGT  
RQPCRfPAS CTTAAGGGTGGCCGGATCA  
groES-fo(2) CCCAAAGCGGTAAGGTTGTT  
groES-re(2) CTTCACGCTGGGGTCAACTT  
pfk-fo1 TCCAGGGACGATCGATAATGA  
pfk-re1 GCTTGCACGTTGGTGTTGAAC