Skip to main content

Table 2 Oligonucleotides used in this study

From: Bacillus amyloliquefaciens GA1 as a source of potent antibiotics and other secondary metabolites for biocontrol of plant pathogens

Name Sequence 5'-3' Metabolite, gene or flanking region
bacAF1 GTGAAGGCCGTACTTTTGTCTGGC Bacilysin, right
bacAR1 GGGGGGAAATACAGCTTCAGGGC Bacilysin, right
beaBF1 GCCCGAAACGGCAGCGCCTG Bacillaene, left
beaBR1 CGGAATGGAGGCTTTGATCCTCTG Bacillaene, left
beaSF1 CGCAAAAGCTCTTCGACCGCCGTC Bacillaene, right
beaSR1 CTCTCGTGCCGTCGGAATATCCGC Bacillaene, right
dfnMF1 CGGAGTGAAACCGTGCCGGGATAAAGA Difficidin, left
dfnMR1 GACCATTCAGAGCGGAAAGCTCC Difficidin, left
dfnAF1 GGTGCGGCATGAAGATTTGAGATCACCG Difficidin, right
dfnAR1 GGAGAGCACTTCAATTCCGACGTTGACC Difficidin, right
dhbFF3 GCCTAGATGACATGGCGGCGG Bacillibactin, left
dhbFR2 GCCGCCGTAGTCGTCCGTGAAGACCG Bacillibactin, left
dhbAF1 CGCCTAAAGTAGCGCCGCCATCAACGC Bacillibactin, right
dhbAR2 CCGCGATGGAGCGGGATTATCCG Bacillibactin, right
fenAF1 CCTCGCTCCGCATGATCTTTTGG Fengycin, left
fenAR1 CGGGAGCACGGTGGCAATGTG Fengycin, left
fenEF1 GTTTCATGGCGGCGAGCACG Fengycin, right
fenER1 GATTCGCGGGAAGCGGATTGAGC Fengycin, right
ituF4 CTGCCTGCGTATATGATTCCGGC Iturin A, left
ituR3 CCGTGATGATGCCGTTCTTCAATCC Iturin A, left
ituF1 CGCCCGTGAAGGAGCAGCCG Iturin A, right
ituR1 GCCAGGAAGCGGGGCTTCAC Iturin A, right
mlnAF1 CGGCTGCGGGGGAAAAGATCCG Macrolactin, left
mlnAR1 CAGCATCAGGGCGTGTATGACCTTC Macrolactin, left
mlnIF1 GGAAGAAAAACAGTCGAGGCGATGCTG Macrolactin, right
mlnIR1 GAGAAGCTCCGCCGTCACCAGTG Macrolactin, right
srfAAF1 GCCCGTGAGCCGAATGGATAAG Surfactin, left
srfAAR1 CCGTTTCAGGGACACAAGCTCCG Surfactin, left
srfADF1 CCGTTCGCAGGAGGCTATTCC Surfactin, right
srfADR1 CGCCCATCCTGCTGAAAAAGCG Surfactin, right
ywfGF1 GAAGAGATCCTCGCCAAACATCCGG Bacilysin, left
ywfGR1 GAGCGGATTGATCCCGCCGTC Bacilysin, left
nrsAR1 GGAGGAGCTAATGACCCATCC nrsAB
nrsBF2 CTCCTATGGAGCACGATCCAAC nrsAB
nrsCF1 GGAATGCTGGTCCATTCAGCC nrsC
nrsCR1 CAATCGCCAGTATCCTCGCAG nrsC
nrsDF1 CCCAACTTATTTCACCGCCC nrsD
nrsDR1 GTAAGGCTCGGCATTGAATCGAG nrsD
nrsEF1 GGTGTGAAATCGTTGCGTTGG nrsED
nrsER1 CAACAGGTAGCGTATGCGTGC nrsED
nrsFF1 CGTACAGCCGGGCCAACTTCAAC nrsF
nrsFR1 GGGCGTGCATATTAGGTGGAATC nrsF
recAf TGAGTGATCGTCAGGCAGCCTTAG recA
recAr TTCTTCATAAGAATACCACGAACCGC recA
recNf CTTTTGCGATCAGAAGGTGCGTATCCG recN
recNr GCCATTATAGAGGAACTGACGATTTC recN
mrsF2 CTTGTGCCAATTCCCGGCTGAC mrsK2
mrsR1 GGATGGCCGGTGTCTCACATG mrsK2
mrsF3 CCATCGGTTTTCCCCATACCCATG mrsK2R2
mrsR2 GTGGGGGGAGTTTTATGGCGGAG mrsK2R2
mrsF4 GGTGAAGCCATCAGTGTCCGG mrsR2
mrsR3 CCAGCACCATTCGGTCCAAGAAAACC mrsR2
mrsF5 GTGGCTGTCTCAAACAGAACCGG mrsG
mrsR4 GTTGCGGCTAATGGAAAACCCAGACC mrsG
mrsF6 GGGCCTTTGTTAGGTGTATCCCTGG mrsE
mrsR5 GGAAGACTCCCGCTTATGCCTAAC mrsE
mrsF7 CCAGTGAACATGAGGAGCCC mrsE-fbabB
mrsR6 CGCGATGACAAAAGAAGTCGCCG mrsE-fbabB
sboA1 CTTCATTTGTTCCGCAATGTTCA sboA
sboA2 CCCAGTGGGCCAATTGAATCCTCCC sboA
ablB1 CGCGCAAGTAGTCGATTTCTAACA albA
ablB2 CAAGTTTGGGCAAAAGAGCTTTTTC albA