Skip to main content

Advertisement

Table 1 Primers used for PCR amplifications

From: Overexpression of the riboflavin biosynthetic pathway in Pichia pastoris

ScR1fw GTACGGCCCAGCCGGCCACGATGACCATAGATAACTACGAC
ScR1bw GTACGCGGCCGCTTATATTGCCAGCGTCGATG
PpR1fw GTACGGCCCAGCCGGCCACGATGTCCGCCGCTCACGATATTTC
PpR1bw GTACGCGGCCGCATCATTTCACCATTAC
PpR1fwPro GTACGCGGCCGCTGGTTTGCCGTTTCATCAGC
PpR1bwPro GTACGGATCCCGCAAGAGTGGGGCATAAAAT
PpR2fw GTACGGCCCAGCCGGCCACGATGAGTAAAAGACTTCCACAGAGAGATGC
PpR2bw GTACGCGGCCGCCTTTGGTTTTTCCGGCTCGTATTTG
PpR2fwPro GTACGGATCCCTGGTAATATCTTGTAACTAATCC
PpR2bwPro GTACGGATCCATCCCCAAGACTTCTACACTACAT
PpR3fw GTACGGCCCAGCCGGCCACGATGTCCGTGTTTACGCCAATAGAG
PpR3bw GTACGCGGCCGCTCTCTGTATTCCTATCCATCGTATC
PpR3fwPro GTACGGATCCGTGGCGTGTATGAGGTAAAACTGC
PpR3bwPro GTACGGATCCAGGGCTAATGACGGACAACTTCTT
PpR4fw GTACGGCCCAGCCGGCCACGATGCTCATATTACGTAATAC
PpR4bw GTACGCGGCCGCGAGGGCTCTTAACAAATAC
PpR4fwPro GTACGGATCCGCCTCGTCACCTTCGTCATCT
PpR4bwPro GTACGGATCCTTGCCTCACTGTGTCTTTCTTTAT
PpR5fw GTACGGCCCAGCCGGCCACGATGTTTACGGGAATAGTGGAAAT
PpR5bw GTACGCGGCCGCCCCTAGTTAGATATAAAATGGAG
PpR5fwPro GTACGGATCCCCCATTGCGAGCGACCTTC
PpR5bwPro GTACGGATCCAAATTTTTCCATCACTTATC
PpR7fw GTACGGCCCAGCCGGCCACGATGTCATTTGTGCCCTTTCTTG
PpR7bw GTACGCGGCCGCGTGGTCGGTATGCCAGTTATAG
PpR7fwPro GTACGGATCCCGATCTGGGTTATTCTCTTCTTTA
PpR7bwPro GTACGGATCCTCTTTGGACGGCGGTGTG
  1. Sc: S. cerevisiae, Pp: P. pastoris, R1-7: RIB1-RIB7 gene, fw: forward primer, bw: backward primer, no addition signifies that this primer pair is for amplification of the complete coding sequence, addition of Pro signifies that this primer pair is for the amplification of the upstream sequence.