Skip to main content

Advertisement

Table 3 Nucleotide sequences of the primers sets used for RT-PCR assays. The rest of the primer sets has been already reported [18].

From: Metabolic transcription analysis of engineered Escherichia coli strains that overproduce L-phenylalanine

Gene Primer Primer sequence
Aromatic amino acid pathways
aroF aroFa 5' CAGAATCCGTGGTTGCTCAA 3'
  aroFb 5' CGGTTGCTCGGAAGACTGAT 3'
aroG aroGa 5' GTCGGCTTCAAAAATGGCAC 3'
  aroGb 5' CCCCATTTCGTTACGGACAG 3'
aroH aroHa 5' CTGCTCGATCCACGATCTCA 3'
  aroHb 5' AGGTGCGCATTACGATTTCC 3'
aroB aroBa 5' GTTATCCTCCCTGACGGCG 3'
  aroBb 5' ACCAGCGTAGTATCGCGACC 3'
aroD aroDa 5' AGCCGAAGAAATCATTGCCC 3'
  aroDb 5' ACGTCAGCACATCGCTGGTA 3'
aroE aroEa 5' AATCCGATAGCCCACAGCAA 3'
  aroEb 5' TCATTGATGGGTGCCAACAC 3'
ydiB ydiBa 5' AAAAGCGGGATTGCCATTTA 3'
  ydiBb 5' CAGTTCCGCGCATTTTGAG 3'
aroL aroLa 5' CCGGAAGAAGATTTACGGCC 3'
  aroLb 5' TGCGCAACTTCGCGATATAG 3'
aroK aroKa 5' GCACTATTGGGCGCCAGTTA 3'
  aroKb 5' GAAAACCCAGCCCACATCAG 3'
aroM aroMa 5' CCAGAAGCAGGCGAAGACAC 3'
  aroMb 5' TCAACCACACCTTGCAGGTC 3'
aroA aroAa 5' CATATTCCTGATGCGGCGAT 3'
  aroAb 5' TCGGTCTCTTTAACACGCCAG 3'
aroC aroCa 5' GGGACATCGCGCTATACCAC 3'
  aroCb 5' AACAAGCCAATGCTGGTGC 3'
pheA pheARa 5' ATGACCCGTCTGGAATCACG 3'
  pheARb 5' GCTTTTTGCATTTCCGCTG 3'
pheA-ev2 pheAa 5' ACTCAGCAGGCTTTGCTCCA 3'
  pheAb 5' GCCGCAAGATGGGAATAAGAA 3'
tyrA tyrAa 5' GTCAGATGGGACGCCTGTTC 3'
  tyrAb 5' GGCAACAATATCAGCCGCTC 3'
aspC aspCa 5' GGCGATTCGCGCTAACTACT 3'
  aspCb 5' GCTCTTGTTCCCAAATCGCA 3'
trpE trpEa 5' CGCAACTGTCAGCGGAAAAT 3'
  trpEb 5' GGCCTGAATACGGGTGCTTT 3'
trpA trpAa 5' CGTTCCTTTCGTCACGCTC 3'
  trpAb 5' CGTTCCTTTCGTCACGCTC 3'
Aromatic amino acid transport
pheP phePa 5' CGGCTGTATTGCTGGGCTAC 3'
  phePb 5' AAATGAACCGGATACCGGCT 3'
aroP aroPa 5' TGGTAATCAACTGGGCGATG 3'
  aroPb 5' CGGATAAAGCAGAGCAGGGA 3'
tyrP tyrPa 5' CCGGTGTTGGTTTTAGCGTT 3'
  tyrPb 5' CGGAACATGCTGGTACACCTC 3'
mtr mtra 5' TTGATGTGCTGGTACAGGCG 3'
  mtrb 5' GAGGAACGAACTCGCTACCG 3'
shiA shiAb 5' ATTATCAAGCTGCCGCGAAA 3'
  shiAb 5' CAATTCGCACAGTCGTAGCG 3'
ilvE ilvEa 5' AAGGCATCCGTTGCTACGAC 3'
  ilvEb 5' CGGGAAGCGATAGATTTTGG 3'
aroP aroPa 5' TGGTAATCAACTGGGCGATG 3'
  aroPb 5' CGGATAAAGCAGAGCAGGGA 3'
Regulators
trpR trpRa 5' CAGAACAGCGTCACCAGGAG 3'
  trpRb 5' TGGCGTCAGCATCAGGTTTA 3'
tyrR tyrRa 5' GGCGAGCTGTCAGCTTTTTG 3'
  tyrRb 5' CGCTTTCCAGCCAACGTAAA 3'
csrA csrAa 5' TCTGACTCGTCGAGTTGGTGA 3'
  csrAb 5' GGGCATTTACGCCAATACGT 3'
rpoD rpoDa 5' GATTCTGCGACCACCGAAAG 3'
  rpoDb 5' TCGATACCGAAACGCATACG 3'
rpoE rpoEa 5' GAACTATTGAGTCCCTCCCGG 3'
  rpoEb 5' CGGACAATCCATGATAGCGG 3'
fnr fnra 5' CGGAAAAGCGAATTATACGGC 3'
  fnrb 5' TTCGTTGAGTGTGAACGGGA 3'
Carbohydrate transport
malE malEa 5' AGAAATTCCCACAGGTTGCG 3'
  malEb 5' TTCAGCCAACAGGCCAGATT 3'