Skip to main content

Table 6 Oligonucleotides used in this study. Designed restriction sites in the primers are shown underlined in the table.

From: Thioredoxin reductase is a key factor in the oxidative stress response of Lactobacillus plantarum WCFS1

Oligonucleotides (5'-3') Sequence References
Lp_0075-FORW ACGTGAATTC CAGTTCAACTAGAACAAGC  
Lp_0075-REV ACGTGGATCC TACAATCCGTTTCATATTG  
Lp_0077-FORW ACGTGGATCC AAGGCGTCATCAAAATAG  
Lp-0077-REV ACGTTCTAGA CGCAATTTTCTTCACATTAC  
EM1 GGATCC GTTAACGAATTCGGCGCGCCGGCGCCA  
EM2 AGATCT GGCGCCGGCGCGGCGAATTCGTTAACG  
trxB1-FORW ATGGCAAAGAGTTACGACG  
trxB1-REV GTTGCATGC TCAATTAA ATCAGCTACGC  
trxB1-300 TTC AGA ACC AGT CCC AAT GAC  
trxB1-KPN1FORW CGCCCACGGTACC ATGGCAAAGAGTTACGACG  
trxB1-XBA1REV CGCGCCTCTAGA CTCAATTAAATCAGCTACGC  
trxA1-FORW ATGATCGAACCAGTCGATAAG  
trxA1-REV TTAGGCAGGCTTC ACTTC  
trxA2-FORW ATGGTCGCAGCAACTACTG  
trxA2-REV TTATAGATA TTGAGCTAAAGTTTG  
trxA3-FORW ATGATTAAAGAAATACATGACC  
trxA3-REV TTAAGCAAGTGCTTTTTTGAGTTC  
trxH-FORW ATGGCAACTGCA ACTTTAAG  
trxH-REV CTACTTTTCAAGTGTATCTAAG  
trxB2-FORW ATGAGTGCAGAATATGATTTAAC  
trxB2-REV CGGGTACCCCGGTTTCTCGTCCTATTTGC  
trxB2-truncFORW ATT CGG ATC CGT AGT CTC TGC AAG TTG C  
trxB2-truncREV TTT GCG GTA CCA CAG AAT ATG ATT TAA CAA TTA