Skip to main content

Table 4 Oligonucleotides used in this study.

From: Recombinant production of Streptococcus equisimilis streptokinase by Streptomyces lividans

Name Sequence (5'-3' direction) Restriction sites (in italic)
SK-F1 GATATC GCTGGACCTGAGTGGCTG Eco RV
SK-R1 AGATCT TTATTTGTCGTTAGGGTTATCAG Bgl II
PBSXylE-F CCGGGCTGCAGGAAG TCGATTCGGGAGCG -
PBSXylE-R CGCTCCCGAATCGAC TTCCTGCAGCCCGG -
  1. The mutagenic base is in bold face.