Table 4 Probes for fluorescence sandwich hybridisation
From: Antisense RNA based down-regulation of RNaseE in E.coli
Probe | Sequence 5'-3'1 | label |
|---|---|---|
Probe set for detection of rne mRNA | ||
helper1 rne (5') | GCCGCGCTCTTCTTTATCG | - |
detection probe rne | GTTAATGCCGCGCCTTTGTT | 3' digoxigenin |
capture probe rne | CGCCAGACTGATAAAGGTG | 5' biotin |
helper2 rne (3') | GGCATCAGAACCAGATAGC | - |
Probe set for detection of antisense6 mRNA | ||
helper1 (5') anti6 | GACCTGGATATCGAGATCTG | - |
detection anti6 | AGATGGGCAGCGTCTGTAT | 3' digoxigenin |
capture anti6 | capture anti6 | 5' biotin |
helper2 (3') anti6 | AACGCAACTCAGCAGGAAG | - |