Table 2 Probes used in Sandwich hybridization Capture probes were biotin labelled and detection probes contained a Dig tail.
From: Transient increase of ATP as a response to temperature up-shift in Escherichia coli
Name | Sequence (5'-3') | Position |
|---|---|---|
dnaK | ||
Helper probe 1 | GTCGGGATAGTGGTGTTTTT | 1259c |
Capture probe | AGAACACCTGGCTGTGCTTG | 1279c |
Helper probe 2 | CTGGTTGTCTTCAGCGGTAG | 1299c |
Detection probe | TTGTCGCCTGCTTCTTCAAC | 1667c |
Ibp | ||
Capture probe | ACCAGCCACAGCGATAGCAA | 165c (ibpA) |
Detection probe | TTCCAGTTCGCTCTCAGCAA | 186c (ibpA) |
Helper probe | ACCACCAGCAGATTATCCTG | 215c (ibpA) |
Lon | ||
Capture probe | ACTCCAGATACTCCGCCTTC | 355c |
Detection probe | GCCTGAATGGACTCCTGCAT | 1919c |