From: Identification of pathogenic microbial cells and spores by electrochemical detection on a biochip
Name | Function | Sequence* (5' – 3') | 5' Position |
---|---|---|---|
HblC U | PCR upper primer for hblC gene | TAATGTTTTAATGAACAACATAACT | 270 |
HblC L | PCR lower primer for hblC gene | ATATCCATGCCTTCCTGTTGAGTTT | 992 |
HblA U | PCR upper primer for hblA gene | GCTAATGTAGTTTCACCAGTAACAAC | 74 |
HblA L | PCR lower primer for hblA gene | AATCATGCCACTGCGTGGACATATAA | 922 |
HblC C | capture probe for hblC gene | X-TCAGTAATGTTTTAATGAACAACATAACT | 270 |
HblC D1 | detection probe 1 for hblC gene | AAACTCAACAGGGCATGGATATACGA-Y | 992 |
HblC D2 | detection probe 2 for hblC gene | GTATGACCAGACAGAAAGGATAAGGACTA-Y | 296 |
HblA C | capture probe for hblA gene | X-CTTAGCTAATGTAGTTTCACCAGTAACAA | 74 |
HblA D1 | detection probe 1 for hblA gene | TTATATGTCCACGCAGTGGCATGATACTA-Y | 922 |
HblA D2 | detection probe 2 for hblA gene | TTTGCAAGTGAAATTGAACAAACGATACA-Y | 101 |