Skip to main content

Table 2 Primers used in this study

From: Highly efficient L-lactate production using engineered Escherichia coli with dissimilar temperature optima for L-lactate formation and cell growth

Primers Sequence (5'-3') restriction sites are italic/underlined Restriction sites
LdhA1 TAAGAATTC aTTATGAAACTCGCCGTTTATAGCACA EcoR Ia
LdhA2 CTTGAATTC a AAGCTT aGCTGCCGGAAATCATCATTTTTT EcoR Ia, Hin dIIIa
LdhA3 GGGCAGCCCGAGCGTCATCAG  
LdhA4 GCTGCCGGAAATCATCATTTTTT  
BcoaLDH1 CCGGATCC aAATCAGGGTGTTGCAGAAGAGCTTG Bam HIa
BcoaLDH4 GCGGAATTC aTTACAATACAGGTGCCATCGTTTCT EcoR Ia
LcaLDH1 CGCGGATCC aAGTATTACGGATAAGGATCAC Bam HIa
LcaLDH4 CGCCTGCAG aTCCTGTTCTTCGTTTG PstI a
StrbLDH1 CGCGGATCC aACTAAACAACACAAAAAAG Bam HIa
StrbLDH2 CCGGAATTC aTACAGGGATTGTTGCCGCA EcoR Ia
LldD1 GGCCCGGG aCATGATTATTTCCGCAGCCA Sma Ia
LldD2 GGCCCGGG aCAGGCAACTCTTTACCCAGCCC Sma Ia
  1. aRestriction sites with corresponding restriction enzyme.