Skip to main content

Table 5 Primers used to create and verify the knock-out strain C. werkmanii DSM17579 ∆ dhaD

From: 1,3-propanediol production with Citrobacter werkmanii DSM17579: effect of a dhaD knock-out

Primer name Sequence (5’ → 3’)
Fw-dhaD-in-P1 AGAGAAGGTACTCAATGGTCTGCATAGCCATGACATTAGCTGCCACGCGGGTGTAGGCTGGAGCTGCTTC
Rv-dhaD-in-P2 AGCCACGGCCATGATCTTGCCATCAATGTCATCTTTTACGCCCATTTCCGCCATATGAATATCCTCCTTAG
Fw-dhaD-in-out GGTCTGCATAGCCATGACATTAGC
Rv-dhaD-in-out TAGCCACGGCCATGATCTTG
SPrimer 46TA TTCCGTGTCGCCCTTATTCC
SPrimer46 TB TAGTGTATGCGGCGACCGAG