Skip to main content

Advertisement

Table 2 Oligonucleotides used in this study

From: Developing a new production host from a blueprint: Bacillus pumilus as an industrial enzyme producer

Oligonucleotide Sequence
P-pVS13_for_long CAGCGTGTAGACAAACCTTCGCATTC
P-pVS13_for_short CCTTCGCATTCGTTGTCAGGTCTGC
P-pVS13/14_rev_long TCCACATCCCTTTTTTCTTATTTCAGAATAATCATC
P-pVS13/14_rev_short TCTTATTTCAGAATAATCATCCGTAGTCTATAAGAATG
P- pVS13/14_RG_for_long AAAAAGGGATGTGGAATGATGAGGAAAAAGAGTTTTTG
P- pVS13/14_RG_for_short ATGATGAGGAAAAAGAGTTTTTGGCTTGGGATGC
P- pVS13/14_RG_rev_short TTGCTCAAAAAAATCTCGGTCAGATGTTACTAGCAACTC
P- pVS13_RG_rev_long TTTGTCTACACGCTGTTGCTCAAAAAAATCTCGGTCAG
P- pVS14_for_long ATGACAAAAACAATGATAAAATAATATTTTTTTATATCG
P- pVS14_for_short ATAAAATAATATTTTTTTATATCGAAATTCGAAATAGCTGC
P- pVS14_RG_rev_long CATTGTTTTTGTCATTTGCTCAAAAAAATCTCGGTCAG
P-pVS19_for_long AGCAACTGGATCTAACAAGAGGAAAGGCCGCC
P- pVS19_for_short TAACAAGAGGAAAGGCCGCCAATTAG
P- pVS19_rev_long TTTTCCTCATCATCATATTCCTCCTTTATGTCCTATATCAAAAATC
P- pVS19_rev_short CATATTCCTCCTTTATGTCCTATATCAAAAATCATACG
P-pVS18_RG_for_long ATGATGAGGAAAAAGAGTTTTTGGCTTG
P-pVS18_RG_for_short AGAGTTTTTGGCTTGGGATGCTGAC
P-pVS18_RG_rev_long GATCCAGTTGCTCAAAAAAATCTCGGT
P-pVS18_RG_rev_short CAAAAAAATCTCGGTCAGATGTTACTAGCA
P-pVS20_for_long AGCAACTGGATCCGAGAACATCTTGAAAGGCA
P-pVS20_for_short CGAGAACATCTTGAAAGGCAGCACAGC
P-pVS20_rev_long TTTTCCTCATCATAATACCCACTCTCCCTTTCATCTTTTTGTC
P-pVS20_rev_short AATACCCACTCTCCCTTTCATCTTTTTGTC
P-pVS23_for GAGCAATTTTAAATGACAAAAACAATGATAAAATAATATTTTTT
P-pVS23_for_short ACAAAAACAATGATAAAATAATATTTTTTTATATCGAAATTCGAAATAG
P-pVS23_rev CATTTAAAATTGCTCAAAAAAATCTCGGTCAGATG
P-pVS23_rev_short AAAAAAATCTCGGTCAGATGTTACTAGCAACTCA
P-pVS24_for CTGTTATATAAACAGGTTCTTTTAAATGACAAAAACAATG
P-pVS24_for_short AGGTTCTTTTAAATGACAAAAACAATGATAAAATAATATTTTTTTATATCG
P-pVS24_rev GTTTATATAACAGGTTCTTGCTCAAAAAAATCTCGGTCAGATG
P-pVS24_rev_short GTTCTTGCTCAAAAAAATCTCGGTCAGATG
pHP5-31_backbone_for_long ATGACGATGAGAAAACGTAAAAATGG
pHP5-31_backbone_for_short GTAAAAATGGATTAATCAGTATTCTATTGGC
pHP5-31_backbone_rev_long CATTTACAAGAACAGCATCTTTCCTCG
pHP5-31_backbone_rev_short CATCTTTCCTCGTTTTTCTTGTACCTG
pTK5/6/7_Insert_for_long CTGTTCTTGTAAATGAGTTGCTAGTAACATCTG
pTK5/6/7_Insert_for_short AGTTGCTAGTAACATCTGACCGAGATTTTTTTGAGC
pTK5_Insert_rev_long GTTTTCTCATCGTCATCATATTCCTCCTTTATGTC
pTK5_Insert_rev_short CATATTCCTCCTTTATGTCCTATATCAAAAATC
pTK6_Insert_rev_long GTTTTCTCATCGTCATTCCACATCCCTTTTTTC
pTK6_Insert_rev_short TCCACATCCCTTTTTTCTTATTTCAGAATAATC
pTK7_Insert_rev_long GTTTTCTCATCGTCATAATACCCACTCTCCCTTTCATC
pTK7_Insert_rev_short AATACCCACTCTCCCTTTCATCTTTTTGTC