Skip to main content

Table 3 Strains, plasmids and primers used in this study

From: Efficient synthesis of L-lactic acid from glycerol by metabolically engineered Escherichia coli

Strain/ Plasmid/Primer Description/Genotype/Sequence Source
Strainsa   
MG1655 F- λ- ilvG- rfb-50 rph-1 [41]
LA01 MG1655 ΔpflB::FRT ΔfrdA::FRT-Kan-FRT; sequential deletion of pflB and frdA in MG1655 [15]
LA02 MG1655 Δpta::FRT ΔadhE::FRT ΔfrdA::FRT-Kan-FRT; sequential deletion of pta, adhE and frdA in MG1655 [15]
LA06 LA01 ΔldhA::FRT-Kan-FRT This study
LA07 LA02 ΔldhA::FRT-Kan-FRT This study
LA19 LA01 ΔmgsA::FRT ΔldhA::ldh This study
LA20 LA02 ΔmgsA::FRT ΔldhA::ldh This study
LA19ΔlldD LA01 ΔmgsA::FRT ΔldhA::ldh ΔlldD::FRT This study
LA20ΔlldD LA02 ΔmgsA::FRT ΔldhA::ldh ΔlldD::FRT This study
Plasmids   
pCP20 reppSC101ts ApR CmR cI857 l PR flp+ [42]
pZSblank Blank plasmid created by removing C. freundii dhaKL from pZSKLcf and self-ligating the plasmid (tetR, oriR SC101*, cat) [11]
pWM91 f1(+) ori lacZ α of pBluescript II (SK+) mobRP4, oriR6K,SacB and AmpR [39]
pZSKLMgldA E. coli dhaKLM and gldA under control of PLtetO-1 (tetR, oriR SC101*, cat) [11]
pZSglpKglpD E. coli glpK and glpD under control of PLtetO-1 (tetR, oriR SC101*, cat) [15]
pZSldh S. bovis ldh under control of PLtetO-1 (tetR, oriR SC101*, cat) This study
Primers b   
v-pflB aaatccacttaagaaggtaggtgtcgtggagcctttattgtac This study
v-frdA taccctgaagtacgtggctgaggtagttgcgtcataaggc This study
v-pta ccaaccaacgaagaactggttagcgcaaatattcccttgc This study
v-adhE cgagcagatgatttactaaaaaagatcggcattgcccagaagg This study
v-lldD cagtttcgatattctggaagcgacagattcatgctgcg This study
v-ldhA gcttaaatgtgattcaacatcactggagaatagaggatgaaaggtcattg This study
c-ldh gacggtaccatgactgcaactaaacaacacaaaaaaggtacggatccttagtttttgcaagcagaagcgaattc This study
r1-ldh tgctgtacatgactgcaactaaacaacactcgtgtacattagtttttgcaagcagaagc This study
r2-ldh cttacggtcaattgttgacgcgtcaacaattgaccgtaag This study
  1. a Deletions were moved into each strain in the order they appear in the “description” column.
  2. b “v”, “c” and “r” indicate the primer sequences (5’ to 3’) that were used for verification purposes (“v”) during gene disruptions, cloning (“c”) of S. bovis ldh, and chromosomal replacement (“r”) of E. coli ldhA with S. bovis ldh (“r”). “r1” and “r2” were used to confirm the presence S. bovis ldh in the E. coli chromosome (“r1”) along wit its presence in the ldhA locus (“r2”). The forward sequence follows the reverse sequence in each case. Genes or operons manipulated are apparent from primer names.