Table 3 Strains, plasmids and primers used in this study
From: Efficient synthesis of L-lactic acid from glycerol by metabolically engineered Escherichia coli
Strain/ Plasmid/Primer | Description/Genotype/Sequence | Source |
|---|---|---|
Strainsa | ||
MG1655 | F- λ- ilvG- rfb-50 rph-1 | [41] |
LA01 | MG1655 ΔpflB::FRT ΔfrdA::FRT-Kan-FRT; sequential deletion of pflB and frdA in MG1655 | [15] |
LA02 | MG1655 Δpta::FRT ΔadhE::FRT ΔfrdA::FRT-Kan-FRT; sequential deletion of pta, adhE and frdA in MG1655 | [15] |
LA06 | LA01 ΔldhA::FRT-Kan-FRT | This study |
LA07 | LA02 ΔldhA::FRT-Kan-FRT | This study |
LA19 | LA01 ΔmgsA::FRT ΔldhA::ldh | This study |
LA20 | LA02 ΔmgsA::FRT ΔldhA::ldh | This study |
LA19ΔlldD | LA01 ΔmgsA::FRT ΔldhA::ldh ΔlldD::FRT | This study |
LA20ΔlldD | LA02 ΔmgsA::FRT ΔldhA::ldh ΔlldD::FRT | This study |
Plasmids | ||
pCP20 | reppSC101ts ApR CmR cI857 l PR flp+ | [42] |
pZSblank | Blank plasmid created by removing C. freundii dhaKL from pZSKLcf and self-ligating the plasmid (tetR, oriR SC101*, cat) | [11] |
pWM91 | f1(+) ori lacZ α of pBluescript II (SK+) mobRP4, oriR6K,SacB and AmpR | [39] |
pZSKLMgldA | E. coli dhaKLM and gldA under control of PLtetO-1 (tetR, oriR SC101*, cat) | [11] |
pZSglpKglpD | E. coli glpK and glpD under control of PLtetO-1 (tetR, oriR SC101*, cat) | [15] |
pZSldh | S. bovis ldh under control of PLtetO-1 (tetR, oriR SC101*, cat) | This study |
Primers b | ||
v-pflB | aaatccacttaagaaggtaggtgtcgtggagcctttattgtac | This study |
v-frdA | taccctgaagtacgtggctgaggtagttgcgtcataaggc | This study |
v-pta | ccaaccaacgaagaactggttagcgcaaatattcccttgc | This study |
v-adhE | cgagcagatgatttactaaaaaagatcggcattgcccagaagg | This study |
v-lldD | cagtttcgatattctggaagcgacagattcatgctgcg | This study |
v-ldhA | gcttaaatgtgattcaacatcactggagaatagaggatgaaaggtcattg | This study |
c-ldh | gacggtaccatgactgcaactaaacaacacaaaaaaggtacggatccttagtttttgcaagcagaagcgaattc | This study |
r1-ldh | tgctgtacatgactgcaactaaacaacactcgtgtacattagtttttgcaagcagaagc | This study |
r2-ldh | cttacggtcaattgttgacgcgtcaacaattgaccgtaag | This study |