Table 1 Oligonucleotides used
From: Stable expression plasmids for Streptomyces based on a toxin-antitoxin system
Name | Sequence 5′-3′ | Use |
|---|---|---|
LS-005 | TTTTTTCATATG TCCATCACCGCCAGCGAAG | Forward oligonucleotide to amplify yefMsl. The sequence recognized by NdeI is underlined. |
LS-022 | TTTTTTCTCGAG CGCCCGCTCCGCGTCCGGG | Reverse oligonucleotide to amplify yefMsl. The sequence recognized by XhoI is underlined. |
MRG-11 | TTTTTTCATATG GCCCGCAGACTCCGCACC | Forward oligonucleotide to amplify the amylase gene (amy) from S. griseus. The sequence recognized by NdeI is underlined. |
MRG-12 | TTTTTTCTCGAG GCCGCGCCAGGTGTCGTTGAG | Reverse oligonucleotide to amplify the amylase gene (amy) from S. griseus. The sequence recognized by XhoI is underlined. |