Skip to main content

Table 1 Primer sequences

From: Photoautotrophic production of D-lactic acid in an engineered cyanobacterium

Primer name Sequence (5′ → 3′)
gldA-o-F GGATCCTTGACAATTAATCATCCGGCTCG
gldA-o-F2 GGATCCTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAGATATAATCATATGACGAAAATCATTACCTCTCCAAGCAAGTTTATACAAGG
gldA-o-F3 ATGACGAAAATCATTACCTCTCCAAG
gldA-o-R GCTAGCTCATGCCCATTTTTCCTTATAATACCGCCCG
gldA-o-R2 TTAGGCCCACTTTTCCTTGTAATAGC
tranNADH-F CCTAAGCTAGCGGAGGACTAGCATGG
tranNADH-R GCTAGCGGTACCTCAAAAAAGCCGG
ptka3-F CCCGAAGTGGCGAGCCCGAT
CO-F TTGATGTTGCCTTTGAACCC
O-F ATGGATACGAAAGTGATTGC
sth-F GAGCTACCACCTGCGCAACA
AMV17R GCGCGACTCCCCGTCTTTGACTATCCTTTTTAGGATGGGGCA
ps1_up_fwda TACCGGAACAGGACCAAGCCTT