Skip to main content

Table 3 Primers used in this study a

From: Engineering NAD+ availability for Escherichia coli whole-cell biocatalysis: a case study for dihydroxyacetone production

Primer Sequence(5′-3′) Function
gldA-F0 TGCTGTATATAGCGCCGCACAAG gldA _cloning
gldA-R0 AGGTTGGTATTGGCCTGGATTTG  
gldA-F1 CAATTTCACACAGGAAACAGACCATGGACCGCATTATTCAATCAC gldA _amplification
gldA-R1 GTGTATATCTCCTTC TCTAGTAGCGATCTATTATTCCCACTCTTGCAGG  
Nox-F1 CTACTAGAGAAGGAGA TATACACATGAAAGTCGTAGTCGTAGG nox _amplification
Nox-R1 CAAAACAGCCAAGCTTGCATGCCTGCAGTTACATATTTTCTAAAGCGGCTTG  
gapAP1-F1 TCGGATATC GAGGCGAGTCAGTCGCGTAATGC Promoter gapAP1 amplification
gapAP1-R1 ACCGAATTC GATCTCATATGTTCCA CCAGCTATTTGTTAG  
gntT105P-F1 CCGTTGATATC TGAAAGGTGTGCGCGATCTCAC PromotergntT105P amplification
gntT105P-R1 GGAATTC TATCTCCT TATTCATTTGCGCTGGGTAACGTCAATTT  
ntt4-F1 TTCGAGCTC ATGAGTAAAACAAACCAGG  
ntt4-R1 AGAGGATCC TTAGTGATGATGATGATGATGTTTTTTTATAAAAG ntt4 amplification
gntT105P-F2 CAAACTCTTTTTGTTTATTTTTCTAAATACATGAAAGGTGTGCGCGATCTC gntT105P + ntt4 amplification
ntt4-R2 CGTTTTATTTGATGCCTGGATCCGCGTCGACTCTAGAGGATCC  
T-F1 GGATCCTCTAGAGTCGACGCGGATCCAGGCATCAAATAAAACG Terminator BBa_B0015 amplification
T-R1 GTATTTAGAAAAATAAACATATAAACGCAGAAAGGCCCAC  
  1. aThe restriction sites were bolded and the ribosome binding sites (RBS) were underlined.