Skip to main content

Advertisement

Table 3 Primers used in PCR and DNA sequencing reactions. F: forward primer, R: reverse primer, underlined: restriction endonuclease site

From: Effective enhancement of Pseudomonas stutzeri D-phenylglycine aminotransferase functional expression in Pichia pastoris by co-expressing Escherichia coli GroEL-GroES

Name Sequence (5-3) Application
FwtdpgA CG GGATCC ACCATGTCGATCCTTAACG Amplifying and cloning
RwtdpgA AG GAATTC TCATGATTGGTTTCCAGAC  
FdpgA _3.5 K CG GGATCC ACCATGTCCATCCTGAACG  
RdpgA _3.5 K AG GAATTC TTAGCAGTGATGGTGAT  
FdpgA _AO G GAATTC ACCATGTCCATCCTGAACGACTACAAGAG  
RdpgA _AO CA GGTCTCCAATT GTTAGCAGTGATGGTGATGGTGATG  
FgroES _GAP G GAATTC ACCATGAATATTCGTCCATTGC  
RgroES _GAP GC TCTAGA TTACGCTTCAACAATTGCCAG  
FgroEL _GAP G GAATTC ACCATGGCAGCTAAAGACGTAAAATTCGGTAACG  
RgroEL _GAP GC TCTAGA TTACATCATGCCGCCCATGCCACC  
FgroES _AO G GAATTC ACCATGAATATTCGTCCATTGC  
RgroES _AO CA GGTCTCCAATT GTTACGCTTCAACAATTGCCAG  
FgroEL _AO G GAATTC ACCATGGCAGCTAAAGACGTAAAATTCGGTAACG  
RgroEL _AO CA GGTCTCCAATT GTTACATCATGCCGCCCATGCCACC  
F_ELS_PICZ CCG CTCGAG TTTTGGTCATGCATGAGATC  
R_ELS_PICZ ATAGTTTA GCGGCCGC TTTTGAAGCTATGGTGTG  
F_GroEL TGTCCGTACCATGCTCTGAC Copy number determination
R_GroEL CAGGTAGCCACGGTCGAAC  
F_D-PhgAT GCCTGCTCCAGGTGTCTTGC  
R_D-PhgAT ACTGTCTAGCCAATTCAGCACC  
F_Actin AAAAGATCTGGCACCACACC  
R_Actin AGTGGTTCTACCGGAAGCG  
5AOX1 GACTGGTTCCAATTGACAAGC DNA sequencing
3AOX1 GCAAATGGCATTCTGACATCC