Skip to main content

Advertisement

Table 4 Primers used in this study.

From: Transcriptome profiling of a curdlan-producing Agrobacterium reveals conserved regulatory mechanisms of exopolysaccharide biosynthesis

Target Gene Forward/Reverse Primer Sequence
Internal gene fragment
nifR F 5'- GCAAGCTT CCCAATCCGCCCGTCCCTC - 3'
  R 5'- CAGAGCTC GAAATGGTCGCCAGCCGC - 3'
ppx1 (AGRO_2774) F 5'- CTAAGCTT GCAGCGAGGTCCAGTGGGTG - 3'
  R 5'- CAGAGCTC CAGTTCCGGGTCGTCGATG - 3'
ppx2 (AGRO_2552) F 5'- CTAAGCTT GCTCCAATCCGCCAGTTCGC - 3'
  R 5'- CAGAGCTC GGTCGGTGGTACATGGCGAA - 3'
rpoN F 5'- GCAAGCTT CATCGAATCGTAACCCGCG - 3'
  R 5'- GCGAGCTC AGCGACCACCTCAATCAG - 3'
rrpP F 5'- GTAAGCTT GATCAGCGCCGTCACGACAAG - 3'
  R 5'- CAGAGCTC CCGCGCAACCCTGCTACCAT - 3'
relA/spoT (AGRO_1497) F 5'- GTAAGCTT GTATGCTCCAGGAACTCTTC - 3'
  R 5'- GAGAGCTC CGTCAAGGGACGTCAGAAAA - 3'
AGRO_0033 F 5'- CGTGACAAGCTT TTCATAGATGCAGGCAACGTC - 3'
  R 5'- GAACGTGAGCTC CTGGTGGGCGGATGATTGT - 3'
AGRO_0636 F 5'- CCTAGAAAGCTT CACAATAGTCGCTGCCAAGT - 3'
  R 5'- CCTAGAGAGCTC GCTTGTCTCGTGACGCTCATT - 3'
AGRO_1729 F 5'- CGTGACAAGCTT CGGGATGGCAATGGTCTCGT - 3'
  R 5'- CTTGTAGAGCTC CTGGCGTTGATACCCATGCT - 3'
AGRO_3967 F 5'- GAGTGTAAGCTT TCCAGCACATAATAGGGCGA - 3'
  R 5'- CTTGGAGAGCTC GACACTTGCGGTTGTCATCG - 3'
Gene knockout confirmation
GMR F 5'- GATGCCCATACTTGAGCCACCTAAC - 3'
nifR R 5'- AAGATCATCATTTGCCTCTTCCGGAG - 3'
ppx1 (AGRO_2774) R 5'- GCGAAGCGATCCCGTCGTGGCAAGA - 3'
ppx2 (AGRO_2552) R 5'- GACTCGATCAGAAGCACAGGGGC - 3'
rpoN R 5'- ATGACGCATTTCGAGCTGACGCAGTT - 3'
rrpP R 5'- ATGCGGTGTCCTGTCCGTGGTTTA - 3'
relA/spoT (AGRO_1497) R 5'- CGCTTTCTTTTTGTGGAATATCGCA - 3'
AGRO_0033 R 5'- GTCGTGTTTCAAGTTTCAGGGTCCG - 3'
AGRO_0636 R 5'- GATGTTGGGTCTTTGGAAAAAACCG - 3'
AGRO_1729 R 5'- ATGAATGGTGAAAAGCGGGGGAGC - 3'
AGRO_3967 R 5'- GGTGAATCGCAGATGATGGAATTGAT - 3'
Quantitative RT-PCR
crdS F 5'- ATCCAATTCAGCACAATCTCG -3'
  R 5'- ACATATCCCCTTTCCATCAG -3'
rpoD F 5'- GGAAATCCAGAACCTCTCCAC -3'
  R 5'- GAACTTGTAACCACGGCGATA -3'
  1. Restriction enzyme sites are underlined. For gene knockout confirmation, the primer homologous to the gentamicin resistance gene (GMR) was used along with a primer homologous to the sequence upstream of the target gene