Skip to main content

Table 5 Primers used for cloning

From: “Direct cloning in Lactobacillus plantarum: Electroporation with non-methylated plasmid DNA enhances transformation efficiency and makes shuttle vectors obsolete”

Primer Sequence 5’→3’ Tm [°C]
mrr_Lp_F ATGAGTTATAAGCGTTGGAATG 60
mrr_Lp_R TCAATCTTGTTCATAATAATATGC 60
hTff1_SacI_F CGAGAGCTC GAATTCAGGTGTGATC 66
Tldh_amp_R CTGCTGGTCGAC AAAAAGATTAAAAAAGCC 64
M13_R_NheI CGACGAGCTAGC AGCCAGGAAACAGCTATGACC 64
Cat_F_NheI CGACGAGCTAGC AATGTGGTCTTTATTCTTCAAC 58
M13_R_XhoI CGACGACTCGAG AGCCAGGAAACAGCTATGACC 64
Cat_F_NheI CGACGAGCTAGC AATGTGGTCTTTATTCTTCAAC 58
hTff1_NheI_F CGACGAGCTAGC GAATTCAGGTGTGATC 66
Tldh_amp_XhoI_R CTGCTGCTCGAG AAAAAGATTAAAAAAGCCGCTGC 62
CAT_seq_R AGTCATTCTTTACAGGAGTCC 60
GG_hTFF1_sense ATGAAGATCAAGTTAACTGTTTTAA 62
CAT_seq_back GTTATTGGGATAAGTTAGAGC 58
p256miniori_for CCCGCACGCATAGCGGTGC 66
  1. Restriction sites are underlined. Tm (melting temperature) was calculated with the program Gene Runner (Version 3.05, Hastings Software Inc., USA).