Skip to main content

Advertisement

Table 4 Oligonucleotide sequences

From: Production of copolyesters of 3-hydroxybutyrate and medium-chain-length 3-hydroxyalkanoates by E. coli containing an optimized PHA synthase gene

Primers for construction and verification of plasmids
pET-F TAAAGGGAACAAAAGCTGGAGCT
pET-R GCCAAGCTT ACGGATGTGAACGTAGGTAC??
pET-HF GCCAAGCTT ACGGATGTGAACGTAGGTAC
qPCR-OmpA-S GTATGGCGTGCAGACACTAA
qPCR-OmpA-A ACTGGTATTCCAGACGGGTAG
qPCR-phaC-S TGATCCAGTACCGTCCGATGT
qPCR-phaC-A GAAGACAGACCCCATTCACG
02SF 5’- ATTGAGCTC GTATTTTGGATGATAACGAGGAGGTAAATAATGCGAGACAAGCCCAATAG a
02SR 5’- AATTACTAGT CCTCAGCGGATATGCACGTAGG -3’
YXXHF 5’- ATAATTGAGCTC CACGTCGACTTATCTCGAGACTG -3’
YXXF 5’- ATAATTGAGCTC GTATTTTGGATGATAACGAGGAG -3’
YXXR 5’- ATAATTACTAGT CCTTAACGGATGTGAACGTAGGT -3’
Tes02F 5’- ATTCTGTGGATAACCGTATTACC -3’
Tes02R 5’- GCACACCTTGTTGATGGTCATGG -3’
  1. aBases underlined indicate Sac I and Spe I restriction sites in the forward and reversed primers, respectively.