Skip to main content

Advertisement

Table 2 PCR primers used in this study

From: Molecular cloning, expression and biochemical characterisation of a cold-adapted novel recombinant chitinase from Glaciozyma antarctica PI12

Primer name Sequence (5'-3') Orientation Use
LChi (F) GAGAATCGCAACTGACTT Forward RT-PCR
LChi (R) GCAGGTGAATTCAGACGG Reverse RT-PCR
3-RC AGGAAACCAGATCGGGATGT ACTGGCC Forward RACE amplification
5-RC GTCGTCGCGCTCCAGGAGCCATAAAT Reverse RACE amplification
CHI-For ATGAAGATCCCTCTCCTCTCCTCC Forward RT-PCR
CHI-Rev CTACGCCTTGAACGTCCCCGCCAGT Reverse RT-PCR
CHI-Not I TTTGCGGCCGC CTCACCCCTACCACTCCCTC Forward PCR
CHI-Xba I TTTTCTAGA AACGCCTTGAACGTCC CCGCCAGT Reverse PCR
  1. The location of Not I and Xba I are underlined