Skip to main content

Advertisement

Table 4 List of primers used for quantification of gene dosage and transcriptional levels by qRT-PCR

From: Protein trafficking, ergosterol biosynthesis and membrane physics impact recombinant protein secretion in Pichia pastoris

Target gene Primer name Primer sequence
ERO1 5'ERO1_qPCR_vie 5' GTTGGAAAAGCCGCATATAAACAAAACA
  3'ERO1_qPCR_vie 5' CAGCTTGGGCAAAGTCCTGTAAGAGTTC
WSC4 5'WSC4_qPCR 5' CAGCACCATCCATATCAACC
  3'WSC4_qPCR 5' GTTTGCGGATCTTGAGCTAC
ACT1 5'ACT1_qPCR_vie 5' CCTGAGGCTTTGTTCCACCCATCT
  3'ACT1_qPCR_vie 5' GGAACATAGTAGTACCACCGGACATAACGA
2F5_HC 5'2F5_HC_qPCR 5' CTCTCACGCTGACCTGTTCC
  3'2F5_HC_qPCR 5' GATTGCAAGCCACTCTAGGG
2F5_LC 5'2F5_LC_qPCR 5' CTTCCCGCCATCTGATGAGC
  3'2F5_LC_qPCR 5' GAGGGCGTTATCCACCTTCC
  1. List of primer sequences used for qRT-PCR assays with both genomic DNA and cDNA.