Skip to main content

Advertisement

Table 3 List of primers used for amplification of genes for co-expression in P.pastoris Fab 2F5

From: Protein trafficking, ergosterol biosynthesis and membrane physics impact recombinant protein secretion in Pichia pastoris

Target gene Primer name Primer sequence
ERO1 ERO1_fwd 5' AACTGCCTGCAGG ACC_ATGAGGATAGTAAGGAGCGTAGCTAT
  ERO1_rev 5' AATCGGGCCGAGGCGGCC _TTACAAGTCTACTCTATATGTGGTATCT
NCE103 NCE103_fwd 5' AAGCGCCTGCAGG ACC_ATGGGTGGTTTATCATTTGA
  NCE103_rev 5' AATCGGGCCGAGGCGGCC _TTAATGTCCACCGGCTTCAGTATCA
AQR1 QDR2_fwd 5' AACTGCCTGCAGG ACC_ATGACAAATGAAAAATTGGATTTG
  QDR2_rev 5' AATCGGGCCGAGGCGGCC _CTACAGTTTGTATTTTGTTCCCCTCCTA
SLY41 SLY41_fwd 5' AACTGCCTGCAGG ACC_ATGATCATTACGCAGAATCT
  SLY41_rev 5' AATCGGGCCGAGGCGGCC _CTAGTTTTTGACTGCACCCCATTT
TDH3 TDH3_fwd 5' AAGCGCCTGCAGG ACC_ATGGCTATCACTGTCGGTAT
  TDH3_rev 5' AATCGGGCCGAGGCGGCC _TTAAGCCTTAGCAACGTGTT
TEF4 TEF4_fwd 5' AACTGCCTGCAGG ACC_ATGTCGCAAGGAACAATTTAC
  TEF4_rev 5' AATCGGGCCGAGGCGGCC _TTAATTACTCTTGGGTGGAACAT
TSA1 TSA1_fwd 5' AACTGCCTGCAGG ACC_ATGTTTGGACTAAATCACGAGATA
  TSA1_rev 5' AATCGGGCCGAGGCGGCC _CTATTTGGACTTGGAAAAGAA
WSC4 WSC4_fwd 5' AACTGCCTGCAGG ACC_ATGTTGTTGAAGTTGATTTGGGTATTT
  WSC4_rev 5' AATCGGGCCGAGGCGGCC _TTAGGCATTATTTCCTGGGGTCTCT
  1. List of primer sequences used for amplification of the target genes from genomic P. pastoris DNA http://www.pichiagenome.org. The sequences of the restriction sites SfiI (GGCC NNNN^NGGCC) and SbfI (CCTGCA^GG) are underlined.