Skip to main content


Table 2 Oligonucleotides used in this study

From: Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

Name Sequence (5'→3') Purpose
Expression vectors  
s6728 ATACAATTCTTTCTAAAGAGGACTTTGGCACATG Mutation between -35 and MtlR binding site
s6729 CCTCTTTAGAAAGAATTGTATAGGGACTGTAAGCGT Mutation between -35 and MtlR binding site
s6801 CCAAAGTCCTCTTTACTAAGTTTTGTATAGGGACTGTAAGCG Mutation between -35 and MtlR binding site
Integration vector  
s5623 GTGTTAGTACGCCGTGCTT Amplification of ptsHI
s5624 GTCGCAATCATAGGGAACAT Amplification of ptsHI
s6949 AAAAAA CCCGGG TAC GAT ATT CCA TAA AAA GC Amplification of mtlR-H342D
Primer extension  
s5959 Cy5-GCTGCAAGGCGATTAAGTTGG Hybridized to lacZ
s5960 Cy5-CCAGTCACGACGTTGTAAAAC Hybridized to lacZ