Skip to main content

Table 2 Oligonucleotides used in this study

From: Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

Name Sequence (5'→3') Purpose
Expression vectors  
s5526 AAAAAAGCTAGCGGCTCCTGAAACCAGGAG Amplification of P mtlA
s5527 AAAAACTTAAGATATAAACCCTCCCTGTTTTG Amplification of P mtlA
s5799 AAGCTAGCTACGATATTCCATAAAAAGC Amplification of P mtlR
s6209 AAAAAGCTAGCTTTTTATTTTTAAAAAATTGTCACAGTCA Shortening upstream of P mtlA
s6210 AAAAAAGCTAGCTAAAAAATTGTCACAGTCATGTGC Shortening upstream of P mtlA
s6213 AAAAAACTTAAGTAAGATACAAAAATATGTTCAGAGA Shortening downstream of P mtlA
s6392 AAAAAACTTAAGAGCCAATCTTGATGTGCGG Amplification of P mtlR
s6688 AAAAAAGCTAGCTTTTTATTTTTAAAAAATTGTCACAGTCATGTGCCAAAGTCCTGAAATCTTTCAA TTGTATAGGGACTG Mutation between -35 and MtlR binding site
s6726 AAAAAAGCTAGCTATTTTTAAAAAATTGTCACAGT Shortening upstream of P mtlA
s6727 AAAAAACTTAAGAGAGAATGATGCTTCCCTTTG Shortening downstream of P mtlA
s6728 ATACAATTCTTTCTAAAGAGGACTTTGGCACATG Mutation between -35 and MtlR binding site
s6729 CCTCTTTAGAAAGAATTGTATAGGGACTGTAAGCGT Mutation between -35 and MtlR binding site
s6792 AAAAAAGCTAGCTTTATTTTTAAAAAATTGTCACA Shortening upstream of P mtlA
s6793 AAAAAAGCTAGCTTTTTAAAAAATTGTCACAGTC Shortening upstream of P mtlA
s6800 CGCTTACAGTCCCTATACAAAACTTAGTAAAGAGGACTTTGGCAC Mutation between -35 and MtlR binding site
s6801 CCAAAGTCCTCTTTACTAAGTTTTGTATAGGGACTGTAAGCG Mutation between -35 and MtlR binding site
s6829 AAAAAAGCTAGCTTTAAAAAATTGTCACAGTCAT Shortening upstream of P mtlA
s6830 AAAAAAGCTAGCAAAAATTGTCACAGTCATGTG Shortening upstream of P mtlA
s7065 AAAAAAGCTAGCTTTTTATTTTTAAAAAATTGTCACAGTCATGTGCCAAACAGGACTTTACTTTCAA TTGTATAGGG Mutation between -35 and MtlR binding site
s7091 AAAAAAGCTAGCTTTTTATTTTTAAAAAATTGTCACAGTCATGTGGGTTTGTCCTCTTTACTTTCAA TTGTATA Mutation between -35 and MtlR binding site
s7098 AAAAAAGCTAGCAGCTATTGTAACATAATCGGT Fusion of P groE -(cre)-UTR PmtlR
s7189 CCTTAAAACGCTTACAGCAATTCTTATAATAAAGAATCTCC Fusion of P groE -(cre PmtlA )-UTR PmtlR
s7190 TGCTGTAAGCGTTTTAAGGAAACCTCTCTATATCCTCTA Fusion of P groE -(cre PmtlA )-UTR PmtlR
s7191 CCATAAAACGCTTTCAACAATTCTTATAATAAAGAATCTCC Fusion of P groE -(cre PmtlR )-UTR PmtlR
s7192 TGTTGAAAGCGTTTTATGGAAACCTCTCTATATCCTCTA Fusion of P groE -(cre PmtlR )-UTR PmtlR
s7193 CCTGGTAACGCTTTCAACAATTCTTATAATAAAGAATCTCC Fusion of P groE -(cre acsA )-UTR PmtlR
s7194 TGTTGAAAGCGTTACCAGGAAACCTCTCTATATCCTCTA Fusion of P groE -(cre acsA )-UTR PmtlR
s7195 CCTGTTCACGCTTTCAGCAATTCTTATAATAAAGAATCTCC Fusion of P groE -(cre mtlA )-UTR PmtlR
s7196 TGCTGAAAGCGTGAACAGGAAACCTCTCTATATCCTCTA Fusion of P groE -(cre mtlA )-UTR PmtlR
s7237 GTAGAGGATATAGAGAGGTTTCCCAATTCTTATAATAAAGAATCTCC Fusion of P groE -UTR PmtlR
s7238 GGAGATTCTTTATTATAAGAATTGGGAAACCTCTCTATATCCTCTAC Fusion of P groE -UTR PmtlR
Integration vector  
s5069 AAAAAAGAATTCGATATCAGATCTACGCGTTAACCCGGGC Amplification of ermC
s5070 AAAAAACAATTGAATCGATTCACAAAAAATAGG Amplification of ermC
s5621 AAAAAAGGCGCCTGGATTACCGTCTCATCG Amplification of glcT
s5622 AAAAAAGGATCCAACCGCTTCCGCCTCATGAA Amplification of glcT
s5623 GTGTTAGTACGCCGTGCTT Amplification of ptsHI
s5624 GTCGCAATCATAGGGAACAT Amplification of ptsHI
s5809 AAAAAAGATATCAACGCCCTTGCCCTTTC Amplification of ycsN
s5810 AAAAAAAGATCTGCATCAGCTGGTAAACTGAT Amplification of ycsN
s5812 AAAAAAAGGCCTAACACAAATGTTGTTTCTGC Amplification of ydaB
s5860 AAAAAAACTAGTACCTGCATGGCACACGT Amplification of ydaB
s5866 AAAAAAGGATCCATAAGAATTGACCTCCTCT Amplification of glcT-P ptsGHI
s5867 AAAAAAGGATCCTAAGGGTGTTAGTACGCCGT Amplification of ptsHI
s5918 AAAGATCTAACCAGGAGCCTTTTTATTTT Amplification of P mtlA
s5919 CGAAATGTAAGGCGATCATATATAAACCCTCCCTGTT Amplification of P mtlA
s5920 AACAGGGAGGGTTTATATATGATCGCCTTACATTTCG Amplification of mtlD
s5921 AAGATATCGACCGTAAACAGCTTCCGTT Amplification of mtlD
s5994 AAACTAGTAAGAAACTTAATCAATAACCGAC Amplification of ycsA
s5995 AAAGGCCTTCTCGATTCCGCTATAATCAG Amplification of ycsA
s6067 CCTGAAAGAAACACCATGCCCGAAC Amplification of ycnL
s6068 AAGATATCGAAAGAAACACCATGCCCGAAC Amplification of ycnL
s6079 AAAAAAACTAGTCTTTGGCACATGACTGTGACA Amplification of ycnL
s6080 AAAGATCTCTTTGGCACATGACTGTGACA Amplification of ycnL
s6302 AAAAAAGAATTCGGTATCTATCTTTTATGCCAA Amplification of ydjC
s6303 AAAAAAGCTAGCTACGTAGTTCTGTCAGCAATC Amplification of ydjC
s6304 AAAAAACTTAAGATCATTGAAGATGTTTCTTGA Amplification of pspA
s6305 AAAAAACATATGCAGCAATTTGATTCGCCGC Amplification of pspA
s6344 AAAAAAGATATCGATCGCCTTACATTTCGGTGC Amplification of mtlD
s6345 AAAAAACATATGTTAAAATGATGGCGTGCAACG Amplification of mtlD
s6865 GCTGACGGCCGGCTCCAGATCT GCA ATC AAG CCT TCA TAT AA Amplification of mtlR-H342D
s6866 TTATATGAAGGCTTGATTGCAGATC TGG AGC CGG CCG TCA GC Amplification of mtlR-H342D
s6867 AAAAAA ACTAGT TTA CAG TAT GTT TTT TTC TTT CAT Amplification of mtlR-H342D
s6949 AAAAAA CCCGGG TAC GAT ATT CCA TAA AAA GC Amplification of mtlR-H342D
Primer extension  
s5959 Cy5-GCTGCAAGGCGATTAAGTTGG Hybridized to lacZ
s5960 Cy5-CCAGTCACGACGTTGTAAAAC Hybridized to lacZ