Skip to main content

Advertisement

Table 1 Oligonucleotides used in this study

From: Modification of genetic regulation of a heterologous chitosanase gene in Streptomyces lividans TK24 leads to chitosanase production in the absence of chitosan

Aim of primers Name Sequence (5'→3')
For csnN106 coding region cloning* FwcsnN106 CCGGAGACCCGCATGC CCCGGAC
  RvcsnN106 CGGTGCGCCAAGCTT GCGTTCGG
For Pr-WT cloning* FwPr-WT GTCTGCGCGGATCC TGACGGCCC
  RvPr-WT GTCCGGGGCATGC GGGTCTCCGG
PCR-directed mutagenesis for Pr-Pa cloning** SEQ.1 ACAACTTCGTCGCGCACATCCA
  Rw1Pr-Pa ATGAGGAGAGTTCGGACAGTTTC
  Fw2Pr-Pa GAAACTG TCCG AACTCTCCTCAT
  RvcsnN106 TGAGGTCGAAGTTCTTGGCGTT
Verification of pHM8a derivatives integration into hosts Fwgenom CCTGAGAGGCCGGTGAGGAG
  RvcsnN106 TGAGGTCGAAGTTCTTGGCGTT
Presence verification of pFDES derivatives into hosts SEQ.1 ACAACTTCGTCGCGCACATCCA
  T7 promoter TTAATACGACTCACTATAGGG
For Primer extension PE-csnN106 TGGGGTGCTTGAGACGCAT
  1. *Bold nucleotides correspond to restriction site
  2. **Bold nucleotide correspond to mutated nucleotide