Skip to main content

Table 2 List of primers, their corresponding nucleotide sequences and application

From: Extracellular secretion of a recombinant therapeutic peptide by Bacillus halodurans utilizing a modified flagellin type III secretion system

Primer name Nucleotide sequencea Application
SpoIVF CGGAAAGCTT GTTGGTGCAGTGAC Spo0A
SUpR CTAGGATCC GTAAGAGGCTCCTAAATCAACCG Spo0A
SDoF CTAGGATCC GCCATGGTAGCCGATAAGC Spo0A
SDoR CTACCCGGG GATTAATCTGGGCAATGGTTGC Spo0A
UplytCF CTCGGTACC CTTAGAGGAGGGATGAGG LytCE
UplytCR CTCGGATCC ACGGATGACGGTCACCAA LytCE
DolytEF CTCGGATCC TTGAACAAAGCCGCTGCA LytCE
DolytER CTCCCCGGG ACGGCCGATGCCGCGTTA LytCE
FlgMF GTTAGGTACC GATCATTGTCTAGATTG FlgM
FMNtR CTGCTCGAG CATCTTCACCTCAATTTC FlgM
FMCtF CTGCTCGAG CAAGTAATGAGAGGGGGCTC FlgM
FMCR2 CATCCCGGG TTGAGCGTCACCGTAAC FlgM
ClpUp GTAGGTACC CAGCAGGCTCTAAATGTTG ClpP
ClpUpR GTAGGATCC TCGAGAATAAATGTCATACG ClpP
CDoF GGATCC TCGATGAATGCGATAAGAG ClpP
CDoR GATATC TGTCTATCTTGTCCGCTTG ClpP
LacF CTAGGTACC AATCGCTCACATCTC AprX
AprXR1 CGACTCGAG CTGTACCATGGAATATCC AprX
AprXF2 CTACTCGAG CAGCAGAGGGTGCGATTC AprX
AprXR2 CTACCCGGG GACGATTCCGAGATGAAGCAC AprX
σDKpn CTCGGTACC CTCGCGTTACGCTCTTTCTGT FliC
FliCendR CGACGGATCC GCACTCGAG ACGAAGTAATTGTAATAC FliC
FlagXhoF GAGACTCGAG GAATCTGGAGCAGATTATA FLAG tag
FuzendR2 GTCTAGGATCC TTAAAACCAATTCCATAATG Enfuvirtide
NRev CTTAGTCGAC ACCTGCAGCATCGTCTCC N-terminal FliC
CFOR CTACGTCGAC CGCTCTTACCTAGGAGCT C-terminal FliC
CstartR
FuzF
FuzR
GTCTGTCGAC CATTAAAATTTCCTCCTTG
GCTGTCGAC ATGTATACGTCATTAATTCATTCATTAATTGAAGAATCACAAAATCAACAAGAAAAAAATGAACAAGAATTATTAGAATTAGATAAATGGGCATCATT
ATGGAATTGGTTTATGTGGATCCTCG
CGAGGATCC ACATAAACCAATTCCATAATGATGCCCATTTATCTAATTCTAATAATTCTTGTTCATTTTTTTCTTGTTGATTTTGTGATTCTTCAATTAAAGTATGAATTA
ATGACGTATACATGTCGACAGC
C-terminal FliC
Enfuvirtide
Enfuvirtide
  1. a Restriction enzyme sites are underlined.