Skip to main content

Table 1 Oligonucleotide primers used in this study

From: Quantitative transcript analysis of the inducible expression system pSIP: comparison of the overexpression of Lactobacillus spp. β-galactosidases in Lactobacillus plantarum

Primer Sequence 5' - 3'a Tab(°C) Concentrationc(nM) Product size (bp) Tm product (°C)
16S_f TGATCCTGGCTCAGGACGAA 60 250 81 81
16S_r TGCAAGCACCAATCAATACCA   250   
EryR_f CCGTGCGTCTGACATCTAT 60 250 108 79
EryR_r TGCTGAATCGAGACTTGAGTG   250   
LacReu_f CCA GAT TCC GTG GTA TTA CCT TTG TG 60 250 154 80
LacReu_r TAC TACT ACG TCA CGC CAT TGA GGA AC   500   
LacAci_f TCTAGTTCACTACGAAGGTGTCG 60 500 154 76.5
LacAci_r GTCATGCATGTATTCACACTCC   500   
SppKR_f CAAGCCGTTCAAGAAACCGAT 60 250 144 78.5
SppKR_r AGCGCCTTTCGTTGAATAGCC   500   
11n15_f GATGACCCG GAAATTTTTCGC GTCAATCAATTGCCAGC    
11n15_r GACGCG AAAAATTTCCGG GTCATC     
  1. a exchanged codons in 11n15_f and 11n15_r are underlined
  2. b optimized annealing temperature as described in the Materials Section
  3. coptimized concentration as described in the Materials Section