Skip to main content

Advertisement

Table 3 Oligonucleotides used for cloning

From: Genetic response to metabolic fluctuations: correlation between central carbon metabolism and DNA replication in Escherichia coli

Primer name Primer sequence (5'>3') Tm °C Restriction enzyme site
ackaF GGCCCGGG ATGTCGAGTAAGTTAG 58.0 SmaI
ackaR TGGCAAGCTT ACATTCAGGCAGTCAGGCGGCTCG 60.0 HindIII
gpmaF CCGGGTACC ATGGCTGTAACTAAGCTGGTTCTG 66.9 KpnI
gpmaR CGCGGTCGAC TTACTTCGCTTTACCCTGG 65.7 SalI
fbabF TCCGGTACC ATGACAGATATTGCGCAGTTGCTTG 65.6 KpnI
fbabR GGCCGTCGAC TCAGGCGATAGTAATTTTGC 64.4 SalI
pgiF GCCCGGG ATGAAAAACATCAATCCAACGCAGACC 66.8 SmaI
pgiR CGGAAGCTT TGATTAACCGCGCCACGCTTTATAG 65.6 HindIII
ptaF CGGAGGAGGTACC ATGTCCCGTATTATTATG 63.0 KpnI
ptaR GACGAAGCTT AGATTACTGCTGCTGTGCAGAC 64.4 HindIII
tktbF CGGAGGGTACC ATGTCCCGAAAAGACCTTG 54.0 KpnI
tktbR GCGCAAGCTT TCAGGCACCTTTCACTCCC 57.0 HindIII
acebF GAGCGGTACC ATGACTGAACAGGCAACAACAAC 58.0 KpnI
acebR TGTGTCGAC TTACGCTAACAGGCGGTAGCCTGG 58.0 SalI
  1. Sequences of particular oligonucleotides recognized by restriction enzymes listed in corresponding row are underlined.